Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904236778:

Variant ID: vg0904236778 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4236778
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CCGCTTGGAGATGCGCGCGAGCTTCTCAGCTTCTGCGCGATCCTCAGGAAGAGTATTGCCGTCGAGATACGCCCGGATGTCAGTCATCCAAACGACCTGA[T/C]
GAGGGGGGTCGGGGTCGACCCCCTCGGGCCCCGAGGGCCGCGAGTCGCCAAGGGTCGGGGCAGAGGGCGTGTCGTCGGGGTCCCTCGAGGGGTTCGGTCG

Reverse complement sequence

CGACCGAACCCCTCGAGGGACCCCGACGACACGCCCTCTGCCCCGACCCTTGGCGACTCGCGGCCCTCGGGGCCCGAGGGGGTCGACCCCGACCCCCCTC[A/G]
TCAGGTCGTTTGGATGACTGACATCCGGGCGTATCTCGACGGCAATACTCTTCCTGAGGATCGCGCAGAAGCTGAGAAGCTCGCGCGCATCTCCAAGCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.50%	30.80%	12.70%	10.01%	NA
All Indica	2759	71.80%	4.00%	13.34%	10.87%	NA
All Japonica	1512	1.50%	85.40%	4.50%	8.66%	NA
Aus	269	42.40%	1.10%	56.51%	0.00%	NA
Indica I	595	84.70%	5.90%	3.87%	5.55%	NA
Indica II	465	83.40%	1.90%	6.67%	7.96%	NA
Indica III	913	52.50%	4.10%	26.18%	17.31%	NA
Indica Intermediate	786	77.60%	3.70%	9.54%	9.16%	NA
Temperate Japonica	767	1.30%	79.30%	4.43%	14.99%	NA
Tropical Japonica	504	1.40%	96.80%	0.99%	0.79%	NA
Japonica Intermediate	241	2.10%	80.90%	12.03%	4.98%	NA
VI/Aromatic	96	44.80%	13.50%	7.29%	34.38%	NA
Intermediate	90	43.30%	41.10%	5.56%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904236778	T -> DEL	LOC_Os09g08180.1	N	frameshift_variant	Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	N	N	N	N
vg0904236778	T -> C	LOC_Os09g08180.1	missense_variant ; p.His2016Arg; MODERATE	nonsynonymous_codon ; H2016R	Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	unknown	unknown	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904236778	4.94E-07	NA	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904236778	NA	6.94E-14	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	2.13E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	2.10E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	1.75E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	1.59E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	2.31E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	1.86E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	6.46E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	2.43E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	9.38E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	1.79E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	1.21E-23	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	3.01E-06	2.27E-06	mr1698_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	2.18E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	4.34E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	7.64E-20	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	2.01E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	6.66E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904236778	NA	6.66E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251