\
| Variant ID: vg0904231862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 4231862 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATACCACATGCACCGCCTCTACCTACTCTTCTTTCGGGTGGGGACCCACCCTATCTTGACCGGAACTCGACCCGTGCCTTCGCCTGGAAGCTAAGCCACA[G/A]
CTTGTCCTCAAGTGGGGCCCAGCGCCGTCCCTCGCCTGACACGGGGGACAGCCCTGTCATTCCCCCATTAATGGATGAAGACTTGTGGTGGCCGCCTTCC
GGAAGGCGGCCACCACAAGTCTTCATCCATTAATGGGGGAATGACAGGGCTGTCCCCCGTGTCAGGCGAGGGACGGCGCTGGGCCCCACTTGAGGACAAG[C/T]
TGTGGCTTAGCTTCCAGGCGAAGGCACGGGTCGAGTTCCGGTCAAGATAGGGTGGGTCCCCACCCGAAAGAAGAGTAGGTAGAGGCGGTGCATGTGGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.20% | 5.40% | 0.47% | 8.89% | NA |
| All Indica | 2759 | 85.80% | 0.20% | 0.80% | 13.16% | NA |
| All Japonica | 1512 | 83.90% | 15.90% | 0.00% | 0.20% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 91.30% | 0.80% | 0.00% | 7.90% | NA |
| Indica II | 465 | 92.00% | 0.00% | 0.65% | 7.31% | NA |
| Indica III | 913 | 75.10% | 0.00% | 1.75% | 23.11% | NA |
| Indica Intermediate | 786 | 90.50% | 0.10% | 0.38% | 9.03% | NA |
| Temperate Japonica | 767 | 79.40% | 20.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 96.80% | 2.80% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 5.20% | 0.00% | 44.79% | NA |
| Intermediate | 90 | 83.30% | 5.60% | 0.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904231862 | G -> DEL | N | N | silent_mutation | Average:55.675; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 | N | N | N | N |
| vg0904231862 | G -> A | LOC_Os09g08170.1 | upstream_gene_variant ; 1178.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 | N | N | N | N |
| vg0904231862 | G -> A | LOC_Os09g08160.1 | downstream_gene_variant ; 2084.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 | N | N | N | N |
| vg0904231862 | G -> A | LOC_Os09g08180.1 | downstream_gene_variant ; 4081.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 | N | N | N | N |
| vg0904231862 | G -> A | LOC_Os09g08160-LOC_Os09g08170 | intergenic_region ; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904231862 | 6.39E-06 | NA | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0904231862 | NA | 2.07E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0904231862 | NA | 2.96E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904231862 | NA | 2.71E-07 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904231862 | 5.97E-07 | 5.97E-07 | mr1908_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904231862 | NA | 9.57E-07 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |