\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904146189:

Variant ID: vg0904146189 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4146189
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATCAAACCCATTCCACAACAGCAAATTTCACAAGGCAGTAGTCAAACAAAACTACGCTAGGAATCACCTCACATCCGCCCATGACCGTGGGCACGGCT[G/A]
TTCGAACAGTTTTAATAACCTCTGCAGAGGGGGTATACTTTACTCACACGACATTACTAACCCGGATCATCCAGCCCGTGCAGAACGGCCACGACTAGAG

Reverse complement sequence

CTCTAGTCGTGGCCGTTCTGCACGGGCTGGATGATCCGGGTTAGTAATGTCGTGTGAGTAAAGTATACCCCCTCTGCAGAGGTTATTAAAACTGTTCGAA[C/T]
AGCCGTGCCCACGGTCATGGGCGGATGTGAGGTGATTCCTAGCGTAGTTTTGTTTGACTACTGCCTTGTGAAATTTGCTGTTGTGGAATGGGTTTGATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 11.60% 10.79% 43.74% NA
All Indica  2759 21.60% 0.40% 14.50% 63.50% NA
All Japonica  1512 53.70% 33.70% 1.59% 11.04% NA
Aus  269 50.60% 0.00% 18.96% 30.48% NA
Indica I  595 11.60% 0.20% 5.71% 82.52% NA
Indica II  465 22.20% 0.40% 13.55% 63.87% NA
Indica III  913 25.70% 0.40% 21.14% 52.68% NA
Indica Intermediate  786 23.90% 0.60% 13.99% 61.45% NA
Temperate Japonica  767 77.40% 1.80% 1.56% 19.17% NA
Tropical Japonica  504 17.90% 78.20% 1.79% 2.18% NA
Japonica Intermediate  241 53.10% 41.90% 1.24% 3.73% NA
VI/Aromatic  96 30.20% 7.30% 27.08% 35.42% NA
Intermediate  90 32.20% 22.20% 10.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904146189 G -> DEL N N silent_mutation Average:27.987; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0904146189 G -> A LOC_Os09g08040.1 downstream_gene_variant ; 3000.0bp to feature; MODIFIER silent_mutation Average:27.987; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0904146189 G -> A LOC_Os09g08030-LOC_Os09g08040 intergenic_region ; MODIFIER silent_mutation Average:27.987; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904146189 NA 1.07E-18 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 6.22E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.23E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.19E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 4.59E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.99E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.09E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 4.04E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 4.84E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.01E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 6.57E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 6.59E-06 6.57E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.54E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 4.61E-07 5.85E-07 mr1312_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.42E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.01E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.11E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.17E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.88E-08 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.85E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.51E-07 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 4.23E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 7.66E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.71E-07 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.77E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.24E-10 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 4.07E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 9.31E-06 NA mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.60E-07 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.58E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 6.16E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 7.59E-06 7.60E-06 mr1688_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.09E-07 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 5.95E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.56E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.40E-08 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.30E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.66E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 3.34E-07 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 2.31E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.25E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 2.42E-06 2.42E-06 mr1847_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.02E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904146189 NA 1.19E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251