\
| Variant ID: vg0904129441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 4129441 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAGTAGCAAAAGCAAGCAATATGCGAATCGACTCAAGTCTAGCTACCGGCGCAAAAGTTTCACCGAAATCTAATCCTTCGATTTGGGTGAACCCTTGCG[C/A]
CACTAACCTCACCTTGTTCCTTATTATGACCCCGGCCTCGTCTTGCTTGTTGCGGAAGATCCACTTTGTGCCAATCACATTTTGCCGAGGTCGCTCCACC
GGTGGAGCGACCTCGGCAAAATGTGATTGGCACAAAGTGGATCTTCCGCAACAAGCAAGACGAGGCCGGGGTCATAATAAGGAACAAGGTGAGGTTAGTG[G/T]
CGCAAGGGTTCACCCAAATCGAAGGATTAGATTTCGGTGAAACTTTTGCGCCGGTAGCTAGACTTGAGTCGATTCGCATATTGCTTGCTTTTGCTACTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 6.70% | 12.67% | 13.50% | NA |
| All Indica | 2759 | 58.60% | 3.60% | 19.03% | 18.81% | NA |
| All Japonica | 1512 | 92.70% | 0.10% | 2.71% | 4.50% | NA |
| Aus | 269 | 19.00% | 80.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 90.30% | 0.20% | 2.69% | 6.89% | NA |
| Indica II | 465 | 61.50% | 6.90% | 7.74% | 23.87% | NA |
| Indica III | 913 | 29.50% | 1.40% | 41.51% | 27.60% | NA |
| Indica Intermediate | 786 | 66.80% | 6.60% | 11.96% | 14.63% | NA |
| Temperate Japonica | 767 | 88.30% | 0.00% | 4.95% | 6.78% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 0.20% | 1.59% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.40% | 0.83% | 3.32% | NA |
| VI/Aromatic | 96 | 32.30% | 1.00% | 23.96% | 42.71% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 11.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904129441 | C -> DEL | LOC_Os09g08020.1 | N | frameshift_variant | Average:20.203; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg0904129441 | C -> A | LOC_Os09g08020.1 | missense_variant ; p.Ala1235Ser; MODERATE | nonsynonymous_codon ; A1235S | Average:20.203; most accessible tissue: Zhenshan97 flower, score: 47.586 | possibly damaging |
1.795 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904129441 | NA | 2.05E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904129441 | NA | 8.66E-06 | mr1544 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904129441 | 4.65E-06 | 1.24E-08 | mr1952 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904129441 | NA | 1.14E-16 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904129441 | NA | 8.95E-17 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904129441 | NA | 3.33E-18 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904129441 | NA | 4.11E-17 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |