\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904129441:

Variant ID: vg0904129441 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4129441
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTAGCAAAAGCAAGCAATATGCGAATCGACTCAAGTCTAGCTACCGGCGCAAAAGTTTCACCGAAATCTAATCCTTCGATTTGGGTGAACCCTTGCG[C/A]
CACTAACCTCACCTTGTTCCTTATTATGACCCCGGCCTCGTCTTGCTTGTTGCGGAAGATCCACTTTGTGCCAATCACATTTTGCCGAGGTCGCTCCACC

Reverse complement sequence

GGTGGAGCGACCTCGGCAAAATGTGATTGGCACAAAGTGGATCTTCCGCAACAAGCAAGACGAGGCCGGGGTCATAATAAGGAACAAGGTGAGGTTAGTG[G/T]
CGCAAGGGTTCACCCAAATCGAAGGATTAGATTTCGGTGAAACTTTTGCGCCGGTAGCTAGACTTGAGTCGATTCGCATATTGCTTGCTTTTGCTACTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 6.70% 12.67% 13.50% NA
All Indica  2759 58.60% 3.60% 19.03% 18.81% NA
All Japonica  1512 92.70% 0.10% 2.71% 4.50% NA
Aus  269 19.00% 80.70% 0.00% 0.37% NA
Indica I  595 90.30% 0.20% 2.69% 6.89% NA
Indica II  465 61.50% 6.90% 7.74% 23.87% NA
Indica III  913 29.50% 1.40% 41.51% 27.60% NA
Indica Intermediate  786 66.80% 6.60% 11.96% 14.63% NA
Temperate Japonica  767 88.30% 0.00% 4.95% 6.78% NA
Tropical Japonica  504 98.20% 0.00% 0.20% 1.59% NA
Japonica Intermediate  241 95.40% 0.40% 0.83% 3.32% NA
VI/Aromatic  96 32.30% 1.00% 23.96% 42.71% NA
Intermediate  90 78.90% 0.00% 11.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904129441 C -> DEL LOC_Os09g08020.1 N frameshift_variant Average:20.203; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0904129441 C -> A LOC_Os09g08020.1 missense_variant ; p.Ala1235Ser; MODERATE nonsynonymous_codon ; A1235S Average:20.203; most accessible tissue: Zhenshan97 flower, score: 47.586 possibly damaging 1.795 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904129441 NA 2.05E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904129441 NA 8.66E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904129441 4.65E-06 1.24E-08 mr1952 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904129441 NA 1.14E-16 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904129441 NA 8.95E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904129441 NA 3.33E-18 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904129441 NA 4.11E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251