| Variant ID: vg0904124928 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 4124928 |
| Reference Allele: GGCAC | Alternative Allele: TGCAC,G |
| Primary Allele: TGCAC | Secondary Allele: GGCAC |
Inferred Ancestral Allele: Not determined.
ACTCATTGCGGACATGACAACCTTCACATTTGCTTAAATAAAAATGTTAGTCCTCTCTAATCGCATTGTAATTAATCACCAAAATCATTAGGGGCCTAGA[GGCAC/TGCAC,G]
TTTCAATCTCCCCCTTTTTGGTGATTGATGACAATACGATTAGAACACAAGAGAGAATGAATATAATTTAAGGTTTTTTTGGTGCAAAGTTTCAGTGGAA
TTCCACTGAAACTTTGCACCAAAAAAACCTTAAATTATATTCATTCTCTCTTGTGTTCTAATCGTATTGTCATCAATCACCAAAAAGGGGGAGATTGAAA[GTGCC/GTGCA,C]
TCTAGGCCCCTAATGATTTTGGTGATTAATTACAATGCGATTAGAGAGGACTAACATTTTTATTTAAGCAAATGTGAAGGTTGTCATGTCCGCAATGAGT
| Populations | Population Size | Frequency of TGCAC(primary allele) | Frequency of GGCAC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 32.30% | 4.42% | 22.18% | G: 0.83% |
| All Indica | 2759 | 57.40% | 4.10% | 6.63% | 30.59% | G: 1.30% |
| All Japonica | 1512 | 1.10% | 90.00% | 0.86% | 8.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.37% | 0.00% | G: 0.37% |
| Indica I | 595 | 81.50% | 7.70% | 0.84% | 9.92% | NA |
| Indica II | 465 | 55.90% | 3.20% | 2.58% | 31.40% | G: 6.88% |
| Indica III | 913 | 35.40% | 1.20% | 14.02% | 49.40% | NA |
| Indica Intermediate | 786 | 65.50% | 5.20% | 4.83% | 23.92% | G: 0.51% |
| Temperate Japonica | 767 | 1.00% | 84.40% | 1.30% | 13.30% | NA |
| Tropical Japonica | 504 | 1.20% | 97.00% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 1.20% | 93.40% | 1.24% | 4.15% | NA |
| VI/Aromatic | 96 | 12.50% | 9.40% | 9.38% | 68.75% | NA |
| Intermediate | 90 | 28.90% | 46.70% | 3.33% | 18.89% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904124928 | GGCAC -> G | LOC_Os09g08000.1 | upstream_gene_variant ; 2442.0bp to feature; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> G | LOC_Os09g08010.1 | downstream_gene_variant ; 462.0bp to feature; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> G | LOC_Os09g08020.1 | downstream_gene_variant ; 3292.0bp to feature; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> G | LOC_Os09g08000-LOC_Os09g08010 | intergenic_region ; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> DEL | N | N | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> TGCAC | LOC_Os09g08000.1 | upstream_gene_variant ; 2441.0bp to feature; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> TGCAC | LOC_Os09g08010.1 | downstream_gene_variant ; 463.0bp to feature; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> TGCAC | LOC_Os09g08020.1 | downstream_gene_variant ; 3293.0bp to feature; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0904124928 | GGCAC -> TGCAC | LOC_Os09g08000-LOC_Os09g08010 | intergenic_region ; MODIFIER | silent_mutation | Average:16.145; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904124928 | NA | 9.76E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 3.35E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 1.93E-22 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 2.77E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 1.32E-10 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | 4.24E-06 | 1.25E-06 | mr1543_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 5.07E-13 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 2.52E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 4.16E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 4.46E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 7.82E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 4.34E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 3.87E-18 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 8.53E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 4.42E-22 | mr1817_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904124928 | NA | 3.35E-18 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |