\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904123337:

Variant ID: vg0904123337 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 4123337
Reference Allele: TAlternative Allele: C,TC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCTCCCTCTGCCACCTCAGCACCACCCCGCCACGTCGACAGGAGGACGGCGCCAGTGACTCTGGCGCCCCAAAAAGACCATTTTTGAGATTAGTTTTTT[T/C,TC]
AGGGGTTTATTTGCAAAATAATTTTTTCAAAATGACCAAATTGTGAAAAGTCCATCAAGTTCAGATGACCAAATCGTTGGTTTAACTGAAAGTGTCAATT

Reverse complement sequence

AATTGACACTTTCAGTTAAACCAACGATTTGGTCATCTGAACTTGATGGACTTTTCACAATTTGGTCATTTTGAAAAAATTATTTTGCAAATAAACCCCT[A/G,GA]
AAAAAACTAATCTCAAAAATGGTCTTTTTGGGGCGCCAGAGTCACTGGCGCCGTCCTCCTGTCGACGTGGCGGGGTGGTGCTGAGGTGGCAGAGGGAGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 37.70% 12.78% 8.57% TC: 0.11%
All Indica  2759 16.10% 53.40% 17.62% 12.79% TC: 0.18%
All Japonica  1512 91.70% 1.10% 5.42% 1.85% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 10.90% 80.50% 6.55% 2.02% NA
Indica II  465 17.00% 54.20% 17.20% 11.61% NA
Indica III  913 22.80% 26.50% 26.29% 23.88% TC: 0.55%
Indica Intermediate  786 11.60% 63.50% 16.16% 8.78% NA
Temperate Japonica  767 86.60% 0.90% 9.52% 3.00% NA
Tropical Japonica  504 97.80% 1.20% 0.40% 0.60% NA
Japonica Intermediate  241 95.00% 1.20% 2.90% 0.83% NA
VI/Aromatic  96 44.80% 6.20% 29.17% 19.79% NA
Intermediate  90 60.00% 25.60% 8.89% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904123337 T -> DEL N N silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> C LOC_Os09g08000.1 upstream_gene_variant ; 850.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> C LOC_Os09g08010.1 downstream_gene_variant ; 2054.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> C LOC_Os09g08020.1 downstream_gene_variant ; 4884.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> C LOC_Os09g08000-LOC_Os09g08010 intergenic_region ; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> TC LOC_Os09g08000.1 upstream_gene_variant ; 851.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> TC LOC_Os09g08010.1 downstream_gene_variant ; 2053.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> TC LOC_Os09g08020.1 downstream_gene_variant ; 4883.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0904123337 T -> TC LOC_Os09g08000-LOC_Os09g08010 intergenic_region ; MODIFIER silent_mutation Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904123337 NA 4.15E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 3.09E-21 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 1.35E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 5.63E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 2.52E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 7.61E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 3.53E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 2.12E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 2.56E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 6.72E-20 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 3.18E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 2.12E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 7.86E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 5.68E-06 mr1931_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904123337 NA 6.00E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251