\
| Variant ID: vg0904123337 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 4123337 |
| Reference Allele: T | Alternative Allele: C,TC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGCTCCCTCTGCCACCTCAGCACCACCCCGCCACGTCGACAGGAGGACGGCGCCAGTGACTCTGGCGCCCCAAAAAGACCATTTTTGAGATTAGTTTTTT[T/C,TC]
AGGGGTTTATTTGCAAAATAATTTTTTCAAAATGACCAAATTGTGAAAAGTCCATCAAGTTCAGATGACCAAATCGTTGGTTTAACTGAAAGTGTCAATT
AATTGACACTTTCAGTTAAACCAACGATTTGGTCATCTGAACTTGATGGACTTTTCACAATTTGGTCATTTTGAAAAAATTATTTTGCAAATAAACCCCT[A/G,GA]
AAAAAACTAATCTCAAAAATGGTCTTTTTGGGGCGCCAGAGTCACTGGCGCCGTCCTCCTGTCGACGTGGCGGGGTGGTGCTGAGGTGGCAGAGGGAGCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.80% | 37.70% | 12.78% | 8.57% | TC: 0.11% |
| All Indica | 2759 | 16.10% | 53.40% | 17.62% | 12.79% | TC: 0.18% |
| All Japonica | 1512 | 91.70% | 1.10% | 5.42% | 1.85% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 10.90% | 80.50% | 6.55% | 2.02% | NA |
| Indica II | 465 | 17.00% | 54.20% | 17.20% | 11.61% | NA |
| Indica III | 913 | 22.80% | 26.50% | 26.29% | 23.88% | TC: 0.55% |
| Indica Intermediate | 786 | 11.60% | 63.50% | 16.16% | 8.78% | NA |
| Temperate Japonica | 767 | 86.60% | 0.90% | 9.52% | 3.00% | NA |
| Tropical Japonica | 504 | 97.80% | 1.20% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.00% | 1.20% | 2.90% | 0.83% | NA |
| VI/Aromatic | 96 | 44.80% | 6.20% | 29.17% | 19.79% | NA |
| Intermediate | 90 | 60.00% | 25.60% | 8.89% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904123337 | T -> DEL | N | N | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> C | LOC_Os09g08000.1 | upstream_gene_variant ; 850.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> C | LOC_Os09g08010.1 | downstream_gene_variant ; 2054.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> C | LOC_Os09g08020.1 | downstream_gene_variant ; 4884.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> C | LOC_Os09g08000-LOC_Os09g08010 | intergenic_region ; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> TC | LOC_Os09g08000.1 | upstream_gene_variant ; 851.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> TC | LOC_Os09g08010.1 | downstream_gene_variant ; 2053.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> TC | LOC_Os09g08020.1 | downstream_gene_variant ; 4883.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0904123337 | T -> TC | LOC_Os09g08000-LOC_Os09g08010 | intergenic_region ; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904123337 | NA | 4.15E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 3.09E-21 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 1.35E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 5.63E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 2.52E-09 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 7.61E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 3.53E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 2.12E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 2.56E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 6.72E-20 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 3.18E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 2.12E-16 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 7.86E-13 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 5.68E-06 | mr1931_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904123337 | NA | 6.00E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |