\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904094998:

Variant ID: vg0904094998 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4094998
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGACTAGTTCGATCGTCGCGCGACTCCGACGCCGACTCTATCCAGATTCCCAGAGTAGCTCGGACGTACGTACGCGGTATATATCCAGCGCTCCGCTG[A/C]
TTCAACGAGCTACCAACACTACTACAGAAAGCGTTTTTGCATACGGGCGGAATCGATCTTCACATGCGGTTGGCCGGCCCGCATGCGCGAAATGGTCTGC

Reverse complement sequence

GCAGACCATTTCGCGCATGCGGGCCGGCCAACCGCATGTGAAGATCGATTCCGCCCGTATGCAAAAACGCTTTCTGTAGTAGTGTTGGTAGCTCGTTGAA[T/G]
CAGCGGAGCGCTGGATATATACCGCGTACGTACGTCCGAGCTACTCTGGGAATCTGGATAGAGTCGGCGTCGGAGTCGCGCGACGATCGAACTAGTCGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 31.30% 6.94% 7.11% NA
All Indica  2759 76.70% 3.10% 9.89% 10.29% NA
All Japonica  1512 9.90% 88.70% 1.26% 0.13% NA
Aus  269 81.40% 0.40% 12.64% 5.58% NA
Indica I  595 83.50% 7.10% 7.06% 2.35% NA
Indica II  465 78.30% 2.40% 10.11% 9.25% NA
Indica III  913 69.40% 0.70% 10.95% 18.95% NA
Indica Intermediate  786 79.00% 3.40% 10.69% 6.87% NA
Temperate Japonica  767 15.80% 81.70% 2.35% 0.13% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 93.80% 0.41% 0.41% NA
VI/Aromatic  96 57.30% 9.40% 0.00% 33.33% NA
Intermediate  90 48.90% 45.60% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904094998 A -> DEL N N silent_mutation Average:56.265; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0904094998 A -> C LOC_Os09g07960.1 upstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:56.265; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0904094998 A -> C LOC_Os09g07970.1 downstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:56.265; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0904094998 A -> C LOC_Os09g07960-LOC_Os09g07970 intergenic_region ; MODIFIER silent_mutation Average:56.265; most accessible tissue: Minghui63 root, score: 71.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904094998 3.55E-08 NA Plant_height All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904094998 NA 2.34E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 1.92E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 8.95E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 3.37E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 5.12E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 6.53E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 2.23E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 1.21E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 6.24E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 2.66E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 1.53E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 1.47E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 2.99E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 4.25E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 1.26E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998 NA 2.92E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251