Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904094998:

Variant ID: vg0904094998 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4094998
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

TCCGACTAGTTCGATCGTCGCGCGACTCCGACGCCGACTCTATCCAGATTCCCAGAGTAGCTCGGACGTACGTACGCGGTATATATCCAGCGCTCCGCTG[A/C]
TTCAACGAGCTACCAACACTACTACAGAAAGCGTTTTTGCATACGGGCGGAATCGATCTTCACATGCGGTTGGCCGGCCCGCATGCGCGAAATGGTCTGC

Reverse complement sequence

GCAGACCATTTCGCGCATGCGGGCCGGCCAACCGCATGTGAAGATCGATTCCGCCCGTATGCAAAAACGCTTTCTGTAGTAGTGTTGGTAGCTCGTTGAA[T/G]
CAGCGGAGCGCTGGATATATACCGCGTACGTACGTCCGAGCTACTCTGGGAATCTGGATAGAGTCGGCGTCGGAGTCGCGCGACGATCGAACTAGTCGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	31.30%	6.94%	7.11%	NA
All Indica	2759	76.70%	3.10%	9.89%	10.29%	NA
All Japonica	1512	9.90%	88.70%	1.26%	0.13%	NA
Aus	269	81.40%	0.40%	12.64%	5.58%	NA
Indica I	595	83.50%	7.10%	7.06%	2.35%	NA
Indica II	465	78.30%	2.40%	10.11%	9.25%	NA
Indica III	913	69.40%	0.70%	10.95%	18.95%	NA
Indica Intermediate	786	79.00%	3.40%	10.69%	6.87%	NA
Temperate Japonica	767	15.80%	81.70%	2.35%	0.13%	NA
Tropical Japonica	504	3.20%	96.80%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	93.80%	0.41%	0.41%	NA
VI/Aromatic	96	57.30%	9.40%	0.00%	33.33%	NA
Intermediate	90	48.90%	45.60%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904094998	A -> DEL	N	N	silent_mutation	Average:56.265; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0904094998	A -> C	LOC_Os09g07960.1	upstream_gene_variant ; 1852.0bp to feature; MODIFIER	silent_mutation	Average:56.265; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0904094998	A -> C	LOC_Os09g07970.1	downstream_gene_variant ; 554.0bp to feature; MODIFIER	silent_mutation	Average:56.265; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0904094998	A -> C	LOC_Os09g07960-LOC_Os09g07970	intergenic_region ; MODIFIER	silent_mutation	Average:56.265; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904094998	3.55E-08	NA	Plant_height	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904094998	NA	2.34E-16	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	1.92E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	8.95E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	3.37E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	5.12E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	6.53E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	2.23E-17	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	1.21E-18	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	6.24E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	2.66E-10	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	1.53E-16	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	1.47E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	2.99E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	4.25E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	1.26E-19	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904094998	NA	2.92E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251