Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904007458:

Variant ID: vg0904007458 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4007458
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCAGAGATTACCTTGATGAAGCAGAAGAAGATATTTCAAGCAAAGCCTTAGCTCCCCTATCCGATGATGTGAGAAAAATACTGGAAGATATTTCTCAT[T/C]
GGCTAGAAGCATCACTAGATAACTTGGTGACCAACTGTGGCTCGATCCGGGCGAGGTTCACGGACATCCAAGCTCTACTCCCAGATGAACTAGCTGATGT

Reverse complement sequence

ACATCAGCTAGTTCATCTGGGAGTAGAGCTTGGATGTCCGTGAACCTCGCCCGGATCGAGCCACAGTTGGTCACCAAGTTATCTAGTGATGCTTCTAGCC[A/G]
ATGAGAAATATCTTCCAGTATTTTTCTCACATCATCGGATAGGGGAGCTAAGGCTTTGCTTGAAATATCTTCTTCTGCTTCATCAAGGTAATCTCTGATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.00%	2.20%	1.29%	60.43%	NA
All Indica	2759	4.10%	1.70%	1.99%	92.21%	NA
All Japonica	1512	99.10%	0.10%	0.00%	0.86%	NA
Aus	269	1.10%	0.70%	1.12%	97.03%	NA
Indica I	595	8.10%	0.00%	3.87%	88.07%	NA
Indica II	465	3.40%	7.50%	1.51%	87.53%	NA
Indica III	913	1.30%	0.00%	1.97%	96.71%	NA
Indica Intermediate	786	4.80%	1.40%	0.89%	92.88%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	42.70%	51.00%	1.04%	5.21%	NA
Intermediate	90	52.20%	8.90%	2.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904007458	T -> DEL	LOC_Os09g07880.1	N	frameshift_variant	Average:34.166; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0904007458	T -> C	LOC_Os09g07880.1	missense_variant ; p.Trp477Arg; MODERATE	nonsynonymous_codon ; W477R	Average:34.166; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	probably damaging	-3.282	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904007458	NA	1.36E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	2.72E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	1.17E-12	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	5.10E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	5.51E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	5.72E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	2.84E-06	NA	mr1352_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	4.79E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	9.63E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	7.22E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	2.13E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	1.19E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	2.70E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	1.32E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	4.17E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	9.22E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	8.26E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	2.89E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	4.69E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	1.46E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	1.19E-10	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	6.99E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	7.18E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	5.04E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	4.82E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904007458	NA	7.03E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251