\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903984961:

Variant ID: vg0903984961 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3984961
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.51, A: 0.50, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTTAAACCCTAGAGGTTGAAATAGATCGATTTGAGAGAATGCACAAGAGGAAGAGTGATTTACCGGTTGGAGGAGTTGAATCACACCAAGAAACTACC[A/C]
TCTATTGGTGCAAATCAAAGAACACCTCGTGCTTCACCTAGGGTTCCATGCCATGGATCAAAAACTCAACAAAAACACAAACTAATCCATGGAATAGAGA

Reverse complement sequence

TCTCTATTCCATGGATTAGTTTGTGTTTTTGTTGAGTTTTTGATCCATGGCATGGAACCCTAGGTGAAGCACGAGGTGTTCTTTGATTTGCACCAATAGA[T/G]
GGTAGTTTCTTGGTGTGATTCAACTCCTCCAACCGGTAAATCACTCTTCCTCTTGTGCATTCTCTCAAATCGATCTATTTCAACCTCTAGGGTTTAAGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.20% 33.80% 12.40% 10.60% NA
All Indica  2759 60.50% 2.70% 19.35% 17.43% NA
All Japonica  1512 2.20% 97.60% 0.07% 0.13% NA
Aus  269 92.20% 0.00% 4.46% 3.35% NA
Indica I  595 53.60% 5.50% 29.92% 10.92% NA
Indica II  465 54.20% 1.30% 22.37% 22.15% NA
Indica III  913 67.30% 1.00% 12.05% 19.72% NA
Indica Intermediate  786 61.70% 3.30% 18.07% 16.92% NA
Temperate Japonica  767 1.00% 98.80% 0.00% 0.13% NA
Tropical Japonica  504 3.00% 96.80% 0.00% 0.20% NA
Japonica Intermediate  241 4.60% 95.00% 0.41% 0.00% NA
VI/Aromatic  96 59.40% 8.30% 31.25% 1.04% NA
Intermediate  90 37.80% 43.30% 10.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903984961 A -> DEL N N silent_mutation Average:55.822; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg0903984961 A -> C LOC_Os09g07840.1 downstream_gene_variant ; 4858.0bp to feature; MODIFIER silent_mutation Average:55.822; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg0903984961 A -> C LOC_Os09g07850.1 intron_variant ; MODIFIER silent_mutation Average:55.822; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903984961 NA 4.95E-21 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 5.94E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 4.18E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 1.35E-22 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 7.76E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 6.41E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 1.96E-32 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 2.23E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 2.17E-06 NA mr1221_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 1.22E-36 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 1.57E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 1.64E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 4.63E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 5.59E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 1.07E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903984961 NA 5.23E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251