\
| Variant ID: vg0903875315 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 3875315 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 345. )
ATAAGTCTTGTCCCAAAGATCCCTTCGGGTTGCCTCGCATTGACCAGGTAGTTGACTCAACCGCCGGCTGTGAGCTACTCAGCTTTTTGGATTGCTACTC[A/T]
GGATATCATCAGATCCGACTAAAGGAATCCGACTGCTTAAAGACTTCATTCATCACGCCCTTCGGGGCCTACTGCTACATCACCATACCTTTCGGATTAA
TTAATCCGAAAGGTATGGTGATGTAGCAGTAGGCCCCGAAGGGCGTGATGAATGAAGTCTTTAAGCAGTCGGATTCCTTTAGTCGGATCTGATGATATCC[T/A]
GAGTAGCAATCCAAAAAGCTGAGTAGCTCACAGCCGGCGGTTGAGTCAACTACCTGGTCAATGCGAGGCAACCCGAAGGGATCTTTGGGACAAGACTTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 12.40% | 0.51% | 0.19% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 64.60% | 33.30% | 1.59% | 0.53% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 19.80% | 74.20% | 4.37% | 1.59% | NA |
| Japonica Intermediate | 241 | 52.30% | 47.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0903875315 | A -> DEL | LOC_Os09g07680.1 | N | frameshift_variant | Average:55.505; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 | N | N | N | N |
| vg0903875315 | A -> T | LOC_Os09g07680.1 | synonymous_variant ; p.Ser730Ser; LOW | synonymous_codon | Average:55.505; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0903875315 | NA | 2.70E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0903875315 | 3.98E-09 | NA | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0903875315 | NA | 5.44E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 9.66E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 5.93E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 3.14E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 2.10E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 9.85E-06 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 1.59E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 3.41E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 9.13E-13 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903875315 | NA | 2.07E-14 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |