Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903870635:

Variant ID: vg0903870635 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3870635
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATTGCATCATTGGCAGATTCCGATGTGAAAGTTGGTCTGGATGGGGGTCAGCGCAAAAACCAGACCTCATGCACATTTTGGGTTTCATCCCGATCTC[C/T]
AAGGGCATCCACAATGTGATGGAAAAATAGGAAGATACATCGTAGAAATGGTAAATAGCTACTAACAAGCCATAAGCTTACTACTAGGACATAAGTAATT

Reverse complement sequence

AATTACTTATGTCCTAGTAGTAAGCTTATGGCTTGTTAGTAGCTATTTACCATTTCTACGATGTATCTTCCTATTTTTCCATCACATTGTGGATGCCCTT[G/A]
GAGATCGGGATGAAACCCAAAATGTGCATGAGGTCTGGTTTTTGCGCTGACCCCCATCCAGACCAACTTTCACATCGGAATCTGCCAATGATGCAATTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 13.70% 0.19% 0.66% NA
All Indica  2759 99.10% 0.80% 0.04% 0.11% NA
All Japonica  1512 63.80% 36.00% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.10% 0.00% 0.38% NA
Temperate Japonica  767 96.90% 3.00% 0.13% 0.00% NA
Tropical Japonica  504 19.60% 80.40% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 48.50% 0.41% 0.00% NA
VI/Aromatic  96 8.30% 61.50% 5.21% 25.00% NA
Intermediate  90 68.90% 25.60% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903870635 C -> DEL N N silent_mutation Average:50.968; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0903870635 C -> T LOC_Os09g07670.1 upstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:50.968; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0903870635 C -> T LOC_Os09g07680.1 upstream_gene_variant ; 1591.0bp to feature; MODIFIER silent_mutation Average:50.968; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0903870635 C -> T LOC_Os09g07670-LOC_Os09g07680 intergenic_region ; MODIFIER silent_mutation Average:50.968; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903870635 NA 7.05E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903870635 NA 3.28E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 1.92E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 2.81E-08 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 8.57E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 6.01E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 1.44E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 3.94E-08 NA mr1038_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 2.83E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 1.54E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 3.47E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 3.72E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 4.47E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 7.07E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 8.05E-12 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903870635 NA 6.37E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251