\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903779005:

Variant ID: vg0903779005 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3779005
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTAGACCGATATTTTTGCACCCTCTTTTGTAACCACTCTAAATTAGCCTCTTTACTCATTATACAAATTTATATGGCTTAGCCGTGCTACACTAGCC[A/G]
GCTTTACAGAGATAGGTACAAATTTTCCATCGGAGATACTAATAAAATCATAGCTAGAAAGATTCCTCCCCGATAAGCATTGAATATTCCCATGACGCCA

Reverse complement sequence

TGGCGTCATGGGAATATTCAATGCTTATCGGGGAGGAATCTTTCTAGCTATGATTTTATTAGTATCTCCGATGGAAAATTTGTACCTATCTCTGTAAAGC[T/C]
GGCTAGTGTAGCACGGCTAAGCCATATAAATTTGTATAATGAGTAAAGAGGCTAATTTAGAGTGGTTACAAAAGAGGGTGCAAAAATATCGGTCTACAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 25.10% 33.58% 4.87% NA
All Indica  2759 4.70% 40.90% 46.39% 8.05% NA
All Japonica  1512 99.10% 0.30% 0.60% 0.00% NA
Aus  269 1.10% 14.10% 84.01% 0.74% NA
Indica I  595 6.20% 25.90% 52.61% 15.29% NA
Indica II  465 3.40% 30.50% 58.49% 7.53% NA
Indica III  913 3.20% 61.90% 31.87% 3.07% NA
Indica Intermediate  786 6.00% 34.00% 51.40% 8.65% NA
Temperate Japonica  767 99.30% 0.10% 0.52% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 1.66% 0.00% NA
VI/Aromatic  96 46.90% 2.10% 47.92% 3.12% NA
Intermediate  90 54.40% 13.30% 28.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903779005 A -> G LOC_Os09g07530.1 upstream_gene_variant ; 4415.0bp to feature; MODIFIER silent_mutation Average:33.748; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg0903779005 A -> G LOC_Os09g07540.1 intron_variant ; MODIFIER silent_mutation Average:33.748; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg0903779005 A -> DEL N N silent_mutation Average:33.748; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903779005 NA 8.90E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 1.38E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 1.39E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 1.22E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 7.29E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 2.69E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 1.55E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 1.05E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 1.89E-20 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 2.12E-09 mr1781 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 3.27E-17 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 9.95E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 1.62E-22 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903779005 NA 3.03E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251