Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903523933:

Variant ID: vg0903523933 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3523933
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAGATAGAGAAAGAGAAGAAGAGGATGGCCAAGGCATACAACAAAAGGGTGAAAGCAAAGTTGTTTCAAGTTGGAGAATTGGTTTGGAAGACAATTTT[G/A]
CCTTTGGGTACTCGATCCAGGGAGTTTGGTAAGTGGTCTCCTAGTTGGGAGGGTCCTTTTCGAGTATGCGACATTGTTCGAGGGAACACATATTTTTAGA

Reverse complement sequence

TCTAAAAATATGTGTTCCCTCGAACAATGTCGCATACTCGAAAAGGACCCTCCCAACTAGGAGACCACTTACCAAACTCCCTGGATCGAGTACCCAAAGG[C/T]
AAAATTGTCTTCCAAACCAATTCTCCAACTTGAAACAACTTTGCTTTCACCCTTTTGTTGTATGCCTTGGCCATCCTCTTCTTCTCTTTCTCTATCTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 7.50% 2.62% 1.10% NA
All Indica  2759 95.70% 0.30% 3.01% 0.98% NA
All Japonica  1512 74.70% 21.30% 2.38% 1.59% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 97.80% 0.30% 1.85% 0.00% NA
Indica II  465 97.40% 0.20% 2.15% 0.22% NA
Indica III  913 91.70% 0.20% 5.48% 2.63% NA
Indica Intermediate  786 97.70% 0.50% 1.53% 0.25% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 34.50% 55.80% 4.96% 4.76% NA
Japonica Intermediate  241 81.30% 14.50% 4.15% 0.00% NA
VI/Aromatic  96 92.70% 5.20% 1.04% 1.04% NA
Intermediate  90 77.80% 20.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903523933 G -> DEL LOC_Os09g07190.1 N frameshift_variant Average:26.135; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0903523933 G -> A LOC_Os09g07190.1 synonymous_variant ; p.Leu177Leu; LOW synonymous_codon Average:26.135; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903523933 6.82E-07 NA Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903523933 NA 3.69E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903523933 NA 2.64E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 2.46E-21 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 2.93E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.53E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 7.02E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 2.62E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.33E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 2.78E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 8.05E-10 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 2.93E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 5.88E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 3.85E-06 NA mr1702 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 7.99E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.80E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 2.19E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 2.13E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 6.07E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.66E-13 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 5.13E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 5.69E-07 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.41E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 4.44E-33 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.28E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 5.73E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 9.21E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.00E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903523933 NA 1.30E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251