Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903435730:

Variant ID: vg0903435730 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 3435730
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, A: 0.47, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAACTTTCGAGTTAAAATTTAAATTTTAAGGTCAAAATTTGAAAACTTTTAACTTAAAACTTTGAAAAAAATTTTAACTCAAAATTCAAATTTGTAAG[T/A]
TAAATTTTAAAAACTTTCAACTCAGATTTAAAAATTTTCAACTTGATATTTGAAAACTTTCAACTCGAGATTGAAATCTTTCAACTCAAGATTTCAAAAC

Reverse complement sequence

GTTTTGAAATCTTGAGTTGAAAGATTTCAATCTCGAGTTGAAAGTTTTCAAATATCAAGTTGAAAATTTTTAAATCTGAGTTGAAAGTTTTTAAAATTTA[A/T]
CTTACAAATTTGAATTTTGAGTTAAAATTTTTTTCAAAGTTTTAAGTTAAAAGTTTTCAAATTTTGACCTTAAAATTTAAATTTTAACTCGAAAGTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	35.00%	0.06%	0.00%	NA
All Indica	2759	97.40%	2.60%	0.00%	0.00%	NA
All Japonica	1512	1.10%	98.80%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.10%	4.90%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.60%	0.00%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0903435730	T -> A	LOC_Os09g07070.1	downstream_gene_variant ; 3850.0bp to feature; MODIFIER	silent_mutation	Average:21.393; most accessible tissue: Callus, score: 35.681	N	N	N	N
vg0903435730	T -> A	LOC_Os09g07080.1	downstream_gene_variant ; 930.0bp to feature; MODIFIER	silent_mutation	Average:21.393; most accessible tissue: Callus, score: 35.681	N	N	N	N
vg0903435730	T -> A	LOC_Os09g07070-LOC_Os09g07080	intergenic_region ; MODIFIER	silent_mutation	Average:21.393; most accessible tissue: Callus, score: 35.681	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0903435730	NA	1.67E-108	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	1.24E-106	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	2.05E-68	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	8.70E-66	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	5.24E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	3.81E-23	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	3.11E-85	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	1.20E-36	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	5.77E-36	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	1.99E-60	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	1.07E-99	mr1758	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	2.12E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	3.72E-39	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	9.43E-54	mr1889	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	7.66E-29	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	1.75E-110	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	5.79E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	2.19E-22	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	2.50E-45	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	2.26E-137	mr1758_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903435730	NA	6.94E-67	mr1889_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251