Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903356460:

Variant ID: vg0903356460 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 3356460
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 381. )

Flanking Sequence (100 bp) in Reference Genome:

GCTGACCGCCGTTTCTTCGTCTTCTCCGCGCCCAAGCTGATGGCAGGTGGAGGCCCATTGTTCTGTTCATGATGGACGATTATGCTTGCCTTCCTTGTGT[T/A]
GTTCATGTTGCTACTGTGATTGATGATTCTGCTTCTTGTTGCGATTGTGATTCCTGTGATTTGTAATTGGGACAAATGTAATGGAGACGAGAAGAATTGC

Reverse complement sequence

GCAATTCTTCTCGTCTCCATTACATTTGTCCCAATTACAAATCACAGGAATCACAATCGCAACAAGAAGCAGAATCATCAATCACAGTAGCAACATGAAC[A/T]
ACACAAGGAAGGCAAGCATAATCGTCCATCATGAACAGAACAATGGGCCTCCACCTGCCATCAGCTTGGGCGCGGAGAAGACGAAGAAACGGCGGTCAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	10.70%	0.36%	2.03%	NA
All Indica	2759	99.20%	0.70%	0.00%	0.11%	NA
All Japonica	1512	65.10%	28.40%	0.66%	5.82%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.20%	0.50%	0.00%	0.22%	NA
Indica Intermediate	786	98.90%	1.00%	0.00%	0.13%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	21.20%	61.70%	0.99%	16.07%	NA
Japonica Intermediate	241	51.90%	43.20%	2.07%	2.90%	NA
VI/Aromatic	96	54.20%	42.70%	2.08%	1.04%	NA
Intermediate	90	72.20%	17.80%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0903356460	T -> DEL	N	N	silent_mutation	Average:73.124; most accessible tissue: Zhenshan97 young leaf, score: 93.324	N	N	N	N
vg0903356460	T -> A	LOC_Os09g06950.1	3_prime_UTR_variant ; 102.0bp to feature; MODIFIER	silent_mutation	Average:73.124; most accessible tissue: Zhenshan97 young leaf, score: 93.324	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0903356460	T	A	-0.04	-0.02	-0.02	-0.04	-0.04	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0903356460	NA	7.14E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	1.61E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	1.11E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	7.21E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	4.59E-07	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	1.67E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	1.32E-11	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	4.08E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	1.24E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	4.19E-06	5.83E-11	mr1642_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	1.38E-11	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	3.04E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	5.39E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	9.31E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	8.30E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	7.37E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	6.67E-07	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	1.56E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	4.21E-06	NA	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903356460	NA	6.02E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251