\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903263501:

Variant ID: vg0903263501 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3263501
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.11, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCGCATCATTCTAGCATTCCCCTTGTTCCTGAACAAACGCCTTAGCCGTGGTATTATAGGGAAATACCACATCACCTTAGTAGGAATTCTCTTCTTT[A/G]
TTAGCTGCCCGTCAACTTCTCCTGGATTGTCTTGTCTAATCTTGTATGGTAGTGCTTTGCAAACACGACATGCTTCTAGGTTCTCATACTCCTCACCGCG

Reverse complement sequence

CGCGGTGAGGAGTATGAGAACCTAGAAGCATGTCGTGTTTGCAAAGCACTACCATACAAGATTAGACAAGACAATCCAGGAGAAGTTGACGGGCAGCTAA[T/C]
AAAGAAGAGAATTCCTACTAAGGTGATGTGGTATTTCCCTATAATACCACGGCTAAGGCGTTTGTTCAGGAACAAGGGGAATGCTAGAATGATGCGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.10% 0.30% 31.23% 45.37% NA
All Indica  2759 2.70% 0.40% 40.38% 56.51% NA
All Japonica  1512 64.20% 0.00% 2.38% 33.40% NA
Aus  269 0.70% 0.00% 98.14% 1.12% NA
Indica I  595 5.40% 0.70% 34.62% 59.33% NA
Indica II  465 3.00% 0.40% 47.31% 49.25% NA
Indica III  913 0.70% 0.00% 31.54% 67.80% NA
Indica Intermediate  786 2.90% 0.60% 50.89% 45.55% NA
Temperate Japonica  767 97.40% 0.00% 0.65% 1.96% NA
Tropical Japonica  504 20.00% 0.00% 4.56% 75.40% NA
Japonica Intermediate  241 51.00% 0.00% 3.32% 45.64% NA
VI/Aromatic  96 25.00% 0.00% 31.25% 43.75% NA
Intermediate  90 24.40% 1.10% 35.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903263501 A -> G LOC_Os09g06820.1 missense_variant ; p.Ile142Thr; MODERATE nonsynonymous_codon ; I142T Average:25.267; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 possibly damaging -1.552 DELETERIOUS 0.00
vg0903263501 A -> DEL LOC_Os09g06820.1 N frameshift_variant Average:25.267; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903263501 NA 1.39E-108 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 3.65E-108 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 1.71E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 9.58E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 1.28E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 1.13E-29 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 6.75E-33 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 6.48E-37 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 3.43E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 5.18E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 1.57E-20 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 5.84E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 1.13E-28 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 1.81E-108 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 8.70E-06 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 1.05E-06 4.91E-07 mr1291_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 1.40E-15 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903263501 NA 3.96E-43 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251