Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903240255:

Variant ID: vg0903240255 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 3240255
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGATGGAACTTGTACATTGGTGTGGGTAGGGACTGCACTAGCTCAGGCTTGACAAGCGGTTTACCGAGTTCGTACATGTATTTCACTTCCGCCTTTTC[A/G]
ATTGGTACGACTCCTAGCAATTGATCCGTAGTTAGACTGGTGTTAATAACAAATTCTTCTATCGTCATTTCTTCACCGGTCACCAACGGCTCGATCTCCT

Reverse complement sequence

AGGAGATCGAGCCGTTGGTGACCGGTGAAGAAATGACGATAGAAGAATTTGTTATTAACACCAGTCTAACTACGGATCAATTGCTAGGAGTCGTACCAAT[T/C]
GAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTAGTGCAGTCCCTACCCACACCAATGTACAAGTTCCATCAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.40%	12.90%	18.56%	46.17%	NA
All Indica	2759	2.20%	0.80%	22.44%	74.52%	NA
All Japonica	1512	64.20%	34.90%	0.26%	0.66%	NA
Aus	269	1.10%	0.40%	67.66%	30.86%	NA
Indica I	595	4.90%	0.80%	15.46%	78.82%	NA
Indica II	465	1.50%	0.20%	27.74%	70.54%	NA
Indica III	913	0.40%	0.70%	23.33%	75.58%	NA
Indica Intermediate	786	2.80%	1.30%	23.54%	72.39%	NA
Temperate Japonica	767	97.30%	2.10%	0.00%	0.65%	NA
Tropical Japonica	504	20.40%	78.40%	0.40%	0.79%	NA
Japonica Intermediate	241	50.60%	48.10%	0.83%	0.41%	NA
VI/Aromatic	96	1.00%	36.50%	61.46%	1.04%	NA
Intermediate	90	22.20%	27.80%	14.44%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0903240255	A -> G	LOC_Os09g06770.1	downstream_gene_variant ; 3255.0bp to feature; MODIFIER	silent_mutation	Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0903240255	A -> G	LOC_Os09g06780.1	downstream_gene_variant ; 141.0bp to feature; MODIFIER	silent_mutation	Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0903240255	A -> G	LOC_Os09g06790.1	downstream_gene_variant ; 4657.0bp to feature; MODIFIER	silent_mutation	Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0903240255	A -> G	LOC_Os09g06770-LOC_Os09g06780	intergenic_region ; MODIFIER	silent_mutation	Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0903240255	A -> DEL	N	N	silent_mutation	Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0903240255	NA	5.19E-36	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903240255	NA	7.90E-14	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903240255	2.92E-07	NA	Grain_weight	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903240255	NA	3.61E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	1.15E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	4.42E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	3.77E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	2.06E-09	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	8.40E-07	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	1.75E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	2.05E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	1.58E-07	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	4.98E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	3.07E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	5.51E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255	NA	3.69E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251