\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903240255:

Variant ID: vg0903240255 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3240255
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGATGGAACTTGTACATTGGTGTGGGTAGGGACTGCACTAGCTCAGGCTTGACAAGCGGTTTACCGAGTTCGTACATGTATTTCACTTCCGCCTTTTC[A/G]
ATTGGTACGACTCCTAGCAATTGATCCGTAGTTAGACTGGTGTTAATAACAAATTCTTCTATCGTCATTTCTTCACCGGTCACCAACGGCTCGATCTCCT

Reverse complement sequence

AGGAGATCGAGCCGTTGGTGACCGGTGAAGAAATGACGATAGAAGAATTTGTTATTAACACCAGTCTAACTACGGATCAATTGCTAGGAGTCGTACCAAT[T/C]
GAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTAGTGCAGTCCCTACCCACACCAATGTACAAGTTCCATCAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.40% 12.90% 18.56% 46.17% NA
All Indica  2759 2.20% 0.80% 22.44% 74.52% NA
All Japonica  1512 64.20% 34.90% 0.26% 0.66% NA
Aus  269 1.10% 0.40% 67.66% 30.86% NA
Indica I  595 4.90% 0.80% 15.46% 78.82% NA
Indica II  465 1.50% 0.20% 27.74% 70.54% NA
Indica III  913 0.40% 0.70% 23.33% 75.58% NA
Indica Intermediate  786 2.80% 1.30% 23.54% 72.39% NA
Temperate Japonica  767 97.30% 2.10% 0.00% 0.65% NA
Tropical Japonica  504 20.40% 78.40% 0.40% 0.79% NA
Japonica Intermediate  241 50.60% 48.10% 0.83% 0.41% NA
VI/Aromatic  96 1.00% 36.50% 61.46% 1.04% NA
Intermediate  90 22.20% 27.80% 14.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903240255 A -> G LOC_Os09g06770.1 downstream_gene_variant ; 3255.0bp to feature; MODIFIER silent_mutation Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0903240255 A -> G LOC_Os09g06780.1 downstream_gene_variant ; 141.0bp to feature; MODIFIER silent_mutation Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0903240255 A -> G LOC_Os09g06790.1 downstream_gene_variant ; 4657.0bp to feature; MODIFIER silent_mutation Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0903240255 A -> G LOC_Os09g06770-LOC_Os09g06780 intergenic_region ; MODIFIER silent_mutation Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0903240255 A -> DEL N N silent_mutation Average:32.688; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903240255 NA 5.19E-36 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903240255 NA 7.90E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903240255 2.92E-07 NA Grain_weight All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903240255 NA 3.61E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 1.15E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 4.42E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 3.77E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 2.06E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 8.40E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 1.75E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 2.05E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 1.58E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 4.98E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 3.07E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 5.51E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903240255 NA 3.69E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251