\
| Variant ID: vg0903223470 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 3223470 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGACATGCCACCACGACATACCGGAAAGAGGCCGTGACAGGACCCTTCGCATAACCCCCTCTAGCCAAGCACACCACACCTCAGGTTTCACCCCCGTCCC[T/C]
AGCGAGCAACGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGCCGTCGCAGGGCCCGCCCCGCTCCATCACGCCCACCTTTGCCTGG
CCAGGCAAAGGTGGGCGTGATGGAGCGGGGCGGGCCCTGCGACGGCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGTTGCTCGCT[A/G]
GGGACGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGCTAGAGGGGGTTATGCGAAGGGTCCTGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATGTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 29.00% | 14.39% | 3.94% | NA |
| All Indica | 2759 | 56.30% | 13.50% | 23.56% | 6.63% | NA |
| All Japonica | 1512 | 35.60% | 64.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 92.90% | 1.50% | 4.46% | 1.12% | NA |
| Indica I | 595 | 51.90% | 11.80% | 30.25% | 6.05% | NA |
| Indica II | 465 | 44.30% | 15.70% | 26.45% | 13.55% | NA |
| Indica III | 913 | 67.50% | 12.70% | 17.31% | 2.52% | NA |
| Indica Intermediate | 786 | 53.80% | 14.40% | 24.05% | 7.76% | NA |
| Temperate Japonica | 767 | 2.50% | 97.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 79.60% | 20.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.40% | 50.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 25.60% | 16.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0903223470 | T -> DEL | N | N | silent_mutation | Average:38.463; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0903223470 | T -> C | LOC_Os09g06760.1 | upstream_gene_variant ; 2253.0bp to feature; MODIFIER | silent_mutation | Average:38.463; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0903223470 | T -> C | LOC_Os09g06750-LOC_Os09g06760 | intergenic_region ; MODIFIER | silent_mutation | Average:38.463; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0903223470 | NA | 1.08E-10 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 3.28E-13 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 8.08E-12 | mr1206 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 1.76E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 4.38E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 4.98E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | 2.24E-06 | 6.45E-11 | mr1596 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 8.45E-07 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 5.43E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 6.79E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 7.75E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 2.76E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0903223470 | NA | 5.62E-14 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |