\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903180038:

Variant ID: vg0903180038 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3180038
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTAACATTGTTCAAAGCTACTTCCTCCGTCCCAAAAAAAAGACAAACCCTGGTTTCCGTGCCTAACATTTGACCATCCGTCTTATTTAAAAAAATTAT[A/G]
GAAAAAATTAAAAAGATAAATCATGCATAAAGTATTAATCATGTTTTATCATCTAACACTAATAAAAATACTAATTATAAAAAAAATTCATATAAGACGG

Reverse complement sequence

CCGTCTTATATGAATTTTTTTTATAATTAGTATTTTTATTAGTGTTAGATGATAAAACATGATTAATACTTTATGCATGATTTATCTTTTTAATTTTTTC[T/C]
ATAATTTTTTTAAATAAGACGGATGGTCAAATGTTAGGCACGGAAACCAGGGTTTGTCTTTTTTTTGGGACGGAGGAAGTAGCTTTGAACAATGTTAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 11.60% 11.11% 0.04% NA
All Indica  2759 92.30% 0.80% 6.92% 0.00% NA
All Japonica  1512 64.70% 32.00% 3.11% 0.13% NA
Aus  269 18.20% 1.90% 79.93% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 87.10% 0.60% 12.26% 0.00% NA
Indica III  913 94.00% 0.40% 5.59% 0.00% NA
Indica Intermediate  786 88.30% 1.40% 10.31% 0.00% NA
Temperate Japonica  767 97.80% 2.00% 0.26% 0.00% NA
Tropical Japonica  504 20.20% 74.00% 5.36% 0.40% NA
Japonica Intermediate  241 52.70% 39.80% 7.47% 0.00% NA
VI/Aromatic  96 11.50% 24.00% 64.58% 0.00% NA
Intermediate  90 70.00% 18.90% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903180038 A -> G LOC_Os09g06690.1 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:41.257; most accessible tissue: Zhenshan97 root, score: 90.526 N N N N
vg0903180038 A -> G LOC_Os09g06680-LOC_Os09g06690 intergenic_region ; MODIFIER silent_mutation Average:41.257; most accessible tissue: Zhenshan97 root, score: 90.526 N N N N
vg0903180038 A -> DEL N N silent_mutation Average:41.257; most accessible tissue: Zhenshan97 root, score: 90.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0903180038 A G -0.01 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903180038 NA 2.28E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903180038 NA 1.00E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 5.80E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 3.86E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 2.84E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 6.08E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 6.56E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 2.71E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 7.13E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 1.19E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 3.53E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 4.72E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 4.48E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 1.69E-07 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 2.66E-12 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 8.40E-17 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 1.58E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 4.60E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 1.10E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 2.73E-09 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 4.14E-15 mr1642_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 8.26E-12 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 2.14E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 2.17E-09 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 8.18E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 2.37E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903180038 NA 5.39E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251