\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903048899:

Variant ID: vg0903048899 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3048899
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCGAACAAGGTTGAAATGCATACTATACTAGTTTTGATATTCCGCGTTTTGCTGAGGATATGTGGATGAATGCATATTTTATATAATATAAAAGATAG[A/G]
TATATATGTTTAAATAATGTGATAATGATATGGAGATGATAATTTCACATTGCTCGCATATTAAATTCTAAAAATACAACAAAATTATAAATGATATATC

Reverse complement sequence

GATATATCATTTATAATTTTGTTGTATTTTTAGAATTTAATATGCGAGCAATGTGAAATTATCATCTCCATATCATTATCACATTATTTAAACATATATA[T/C]
CTATCTTTTATATTATATAAAATATGCATTCATCCACATATCCTCAGCAAAACGCGGAATATCAAAACTAGTATAGTATGCATTTCAACCTTGTTCGACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 1.40% 0.36% 1.16% NA
All Indica  2759 99.70% 0.10% 0.04% 0.18% NA
All Japonica  1512 94.00% 4.00% 0.99% 0.99% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.00% 0.00% 0.44% NA
Indica Intermediate  786 99.60% 0.30% 0.00% 0.13% NA
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 85.90% 10.30% 2.38% 1.39% NA
Japonica Intermediate  241 93.80% 2.50% 0.41% 3.32% NA
VI/Aromatic  96 67.70% 0.00% 1.04% 31.25% NA
Intermediate  90 91.10% 4.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903048899 A -> G LOC_Os09g06464.1 intron_variant ; MODIFIER silent_mutation Average:72.923; most accessible tissue: Zhenshan97 young leaf, score: 92.102 N N N N
vg0903048899 A -> DEL N N silent_mutation Average:72.923; most accessible tissue: Zhenshan97 young leaf, score: 92.102 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0903048899 A G 0.01 0.0 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903048899 9.56E-06 NA mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903048899 7.82E-07 7.82E-07 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903048899 NA 3.30E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903048899 NA 4.82E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903048899 NA 5.94E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903048899 7.90E-06 NA mr1233 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903048899 NA 9.46E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903048899 9.73E-06 NA mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251