\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902627466:

Variant ID: vg0902627466 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 2627466
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCTCCCTGTGATACCAGCACTGTTTCCTGGGACTGGTATCGATTAACAGGTTAATTTGGAGCGTCACGGGCTAGTTCCGGTCTGGACTAGTTCGGGGC[G/A]
TGACACATCTCTGGCCAACAATGGTGGCCATCGTGGTCACCTTCCCTCCGCCCTAACCCCTCTCAGCTCTCTCCTTAGGTGTCGACGCCGCCCGTCCGCC

Reverse complement sequence

GGCGGACGGGCGGCGTCGACACCTAAGGAGAGAGCTGAGAGGGGTTAGGGCGGAGGGAAGGTGACCACGATGGCCACCATTGTTGGCCAGAGATGTGTCA[C/T]
GCCCCGAACTAGTCCAGACCGGAACTAGCCCGTGACGCTCCAAATTAACCTGTTAATCGATACCAGTCCCAGGAAACAGTGCTGGTATCACAGGGAGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.00% 7.80% 1.59% 62.59% NA
All Indica  2759 2.60% 0.40% 1.20% 95.80% NA
All Japonica  1512 74.50% 22.70% 1.98% 0.86% NA
Aus  269 0.70% 0.00% 1.86% 97.40% NA
Indica I  595 5.00% 0.50% 0.50% 93.95% NA
Indica II  465 1.30% 0.20% 1.08% 97.42% NA
Indica III  913 0.70% 0.20% 1.20% 97.92% NA
Indica Intermediate  786 3.90% 0.50% 1.78% 93.77% NA
Temperate Japonica  767 97.70% 1.60% 0.13% 0.65% NA
Tropical Japonica  504 34.50% 60.10% 4.37% 0.99% NA
Japonica Intermediate  241 84.20% 11.60% 2.90% 1.24% NA
VI/Aromatic  96 91.70% 1.00% 2.08% 5.21% NA
Intermediate  90 40.00% 15.60% 5.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902627466 G -> DEL N N silent_mutation Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 N N N N
vg0902627466 G -> A LOC_Os09g04900.1 upstream_gene_variant ; 815.0bp to feature; MODIFIER silent_mutation Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 N N N N
vg0902627466 G -> A LOC_Os09g04910.1 downstream_gene_variant ; 2864.0bp to feature; MODIFIER silent_mutation Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 N N N N
vg0902627466 G -> A LOC_Os09g04900-LOC_Os09g04910 intergenic_region ; MODIFIER silent_mutation Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902627466 NA 7.72E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.07E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 6.39E-06 1.01E-24 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 8.33E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 9.44E-10 3.38E-22 mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.33E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.86E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 7.71E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 7.69E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 4.53E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 5.75E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 9.03E-24 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.19E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 1.31E-08 1.94E-21 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.10E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 3.31E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 3.00E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 4.49E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 3.97E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.65E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.56E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 1.16E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 2.94E-06 3.02E-10 mr1786_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 2.14E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466 NA 7.64E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251