Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902627466:

Variant ID: vg0902627466 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 2627466
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCTCCCTGTGATACCAGCACTGTTTCCTGGGACTGGTATCGATTAACAGGTTAATTTGGAGCGTCACGGGCTAGTTCCGGTCTGGACTAGTTCGGGGC[G/A]
TGACACATCTCTGGCCAACAATGGTGGCCATCGTGGTCACCTTCCCTCCGCCCTAACCCCTCTCAGCTCTCTCCTTAGGTGTCGACGCCGCCCGTCCGCC

Reverse complement sequence

GGCGGACGGGCGGCGTCGACACCTAAGGAGAGAGCTGAGAGGGGTTAGGGCGGAGGGAAGGTGACCACGATGGCCACCATTGTTGGCCAGAGATGTGTCA[C/T]
GCCCCGAACTAGTCCAGACCGGAACTAGCCCGTGACGCTCCAAATTAACCTGTTAATCGATACCAGTCCCAGGAAACAGTGCTGGTATCACAGGGAGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.00%	7.80%	1.59%	62.59%	NA
All Indica	2759	2.60%	0.40%	1.20%	95.80%	NA
All Japonica	1512	74.50%	22.70%	1.98%	0.86%	NA
Aus	269	0.70%	0.00%	1.86%	97.40%	NA
Indica I	595	5.00%	0.50%	0.50%	93.95%	NA
Indica II	465	1.30%	0.20%	1.08%	97.42%	NA
Indica III	913	0.70%	0.20%	1.20%	97.92%	NA
Indica Intermediate	786	3.90%	0.50%	1.78%	93.77%	NA
Temperate Japonica	767	97.70%	1.60%	0.13%	0.65%	NA
Tropical Japonica	504	34.50%	60.10%	4.37%	0.99%	NA
Japonica Intermediate	241	84.20%	11.60%	2.90%	1.24%	NA
VI/Aromatic	96	91.70%	1.00%	2.08%	5.21%	NA
Intermediate	90	40.00%	15.60%	5.56%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0902627466	G -> DEL	N	N	silent_mutation	Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185	N	N	N	N
vg0902627466	G -> A	LOC_Os09g04900.1	upstream_gene_variant ; 815.0bp to feature; MODIFIER	silent_mutation	Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185	N	N	N	N
vg0902627466	G -> A	LOC_Os09g04910.1	downstream_gene_variant ; 2864.0bp to feature; MODIFIER	silent_mutation	Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185	N	N	N	N
vg0902627466	G -> A	LOC_Os09g04900-LOC_Os09g04910	intergenic_region ; MODIFIER	silent_mutation	Average:73.82; most accessible tissue: Zhenshan97 flag leaf, score: 87.185	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0902627466	NA	7.72E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.07E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	6.39E-06	1.01E-24	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	8.33E-16	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	9.44E-10	3.38E-22	mr1410	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.33E-14	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.86E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	7.71E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	7.69E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	4.53E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	5.75E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	9.03E-24	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.19E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	1.31E-08	1.94E-21	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.10E-13	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	3.31E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	3.00E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	4.49E-06	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	3.97E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.65E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.56E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	1.16E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	2.94E-06	3.02E-10	mr1786_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	2.14E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902627466	NA	7.64E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251