\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902581681:

Variant ID: vg0902581681 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 2581681
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, A: 0.19, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


AGATATGCTCCCTATTCACCTGTTCCTGCGAGACATTCCTCAGTCTACACCTTTCTAGATCCGCTTTGGCCCGTCGAATCCGTTTCTCCAAATCTCCCAG[A/C]
ACCATTTTATCCCATGCCCAGAGGTCGGTCAACACCTTCCTTTCTATTTCTACCAACCTTTCACAGCCATCCTCCAACGCCGCCGTCCATGCTTCCTCCA

Reverse complement sequence

TGGAGGAAGCATGGACGGCGGCGTTGGAGGATGGCTGTGAAAGGTTGGTAGAAATAGAAAGGAAGGTGTTGACCGACCTCTGGGCATGGGATAAAATGGT[T/G]
CTGGGAGATTTGGAGAAACGGATTCGACGGGCCAAAGCGGATCTAGAAAGGTGTAGACTGAGGAATGTCTCGCAGGAACAGGTGAATAGGGAGCATATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 21.80% 0.08% 12.46% NA
All Indica  2759 97.60% 1.70% 0.00% 0.69% NA
All Japonica  1512 1.90% 63.70% 0.26% 34.13% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 95.10% 4.40% 0.00% 0.50% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 99.10% 0.10% 0.00% 0.77% NA
Indica Intermediate  786 96.90% 2.00% 0.00% 1.02% NA
Temperate Japonica  767 0.70% 97.10% 0.00% 2.22% NA
Tropical Japonica  504 3.20% 19.00% 0.60% 77.18% NA
Japonica Intermediate  241 3.30% 50.60% 0.41% 45.64% NA
VI/Aromatic  96 57.30% 3.10% 0.00% 39.58% NA
Intermediate  90 63.30% 20.00% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902581681 A -> DEL LOC_Os09g04850.1 N frameshift_variant Average:68.695; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0902581681 A -> C LOC_Os09g04850.1 synonymous_variant ; p.Val353Val; LOW synonymous_codon Average:68.695; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902581681 NA 4.96E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 6.58E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 9.16E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 1.22E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 9.00E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 5.25E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 7.34E-06 7.34E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 3.32E-09 mr1363_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 4.13E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 5.50E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 1.43E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 6.98E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 5.09E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 2.63E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902581681 NA 3.20E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251