\
| Variant ID: vg0902343614 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 2343614 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 331. )
CTAGGCGCCGTATCCCTAAAGACACAGCAATCCTAAATCCATGAAGTAATGCTTCATACTCAGCTACATTATGGGACGCTGAAAAATGAATCCACAACAC[A/G]
TAGCTAAGCTGCTCTCCAGTCGGGGAAATTAATACAACCCCAGCCCAGTGCCTGAAATTCTTTTCGACCCGTCGAAATGCATAGTCCAGTACTCCAAGTT
AACTTGGAGTACTGGACTATGCATTTCGACGGGTCGAAAAGAATTTCAGGCACTGGGCTGGGGTTGTATTAATTTCCCCGACTGGAGAGCAGCTTAGCTA[T/C]
GTGTTGTGGATTCATTTTTCAGCGTCCCATAATGTAGCTGAGTATGAAGCATTACTTCATGGATTTAGGATTGCTGTGTCTTTAGGGATACGGCGCCTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.20% | 8.70% | 4.36% | 4.72% | NA |
| All Indica | 2759 | 97.00% | 0.10% | 0.65% | 2.21% | NA |
| All Japonica | 1512 | 52.30% | 26.50% | 11.64% | 9.52% | NA |
| Aus | 269 | 95.50% | 0.00% | 0.00% | 4.46% | NA |
| Indica I | 595 | 98.30% | 0.20% | 0.67% | 0.84% | NA |
| Indica II | 465 | 96.30% | 0.00% | 0.00% | 3.66% | NA |
| Indica III | 913 | 96.80% | 0.10% | 0.66% | 2.41% | NA |
| Indica Intermediate | 786 | 96.70% | 0.10% | 1.02% | 2.16% | NA |
| Temperate Japonica | 767 | 42.50% | 47.10% | 10.17% | 0.26% | NA |
| Tropical Japonica | 504 | 60.70% | 1.20% | 14.68% | 23.41% | NA |
| Japonica Intermediate | 241 | 66.00% | 14.10% | 9.96% | 9.96% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 75.60% | 8.90% | 12.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902343614 | A -> G | LOC_Os09g04420.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.65; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0902343614 | A -> DEL | N | N | silent_mutation | Average:58.65; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902343614 | NA | 1.75E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 3.20E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 4.16E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | 1.74E-06 | 1.26E-07 | mr1206_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 1.47E-07 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | 2.82E-06 | 1.47E-10 | mr1229_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 8.61E-09 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 6.54E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 2.78E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 3.73E-08 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 3.19E-06 | mr1555_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | 1.39E-07 | 1.13E-09 | mr1596_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 8.97E-09 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 3.37E-08 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 4.25E-06 | mr1763_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | 3.25E-07 | 4.11E-12 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902343614 | NA | 2.20E-10 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |