\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902278490:

Variant ID: vg0902278490 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 2278490
Reference Allele: TAlternative Allele: G,TGGC
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTGCGCAGCCGGAGCACCGGAGTTGCCGTTGAAGACGATAGGCTCACGAATCCACGAGAAGACCAAGGGATCTGACAAAGAAGAACAAAAGGGAAAGA[T/G,TGGC]
ACGAAGAGGAAGGATGGATCTGGAAGAGTGGAAGGAAGGCGACTCAGGCGACCATGCATGGCCAGTGGACCTCATGCGCCCCTCGTGCAAGTCAGGCGAG

Reverse complement sequence

CTCGCCTGACTTGCACGAGGGGCGCATGAGGTCCACTGGCCATGCATGGTCGCCTGAGTCGCCTTCCTTCCACTCTTCCAGATCCATCCTTCCTCTTCGT[A/C,GCCA]
TCTTTCCCTTTTGTTCTTCTTTGTCAGATCCCTTGGTCTTCTCGTGGATTCGTGAGCCTATCGTCTTCAACGGCAACTCCGGTGCTCCGGCTGCGCAGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.70% 17.30% 1.76% 57.22% TGGC: 0.06%
All Indica  2759 4.70% 5.50% 2.90% 86.77% TGGC: 0.11%
All Japonica  1512 63.60% 35.60% 0.00% 0.86% NA
Aus  269 0.70% 1.10% 0.74% 97.40% NA
Indica I  595 12.10% 1.80% 4.87% 81.18% NA
Indica II  465 2.40% 7.70% 2.58% 87.31% NA
Indica III  913 0.90% 6.00% 2.52% 90.36% TGGC: 0.22%
Indica Intermediate  786 5.10% 6.20% 2.04% 86.51% TGGC: 0.13%
Temperate Japonica  767 97.10% 2.20% 0.00% 0.65% NA
Tropical Japonica  504 18.80% 80.20% 0.00% 0.99% NA
Japonica Intermediate  241 50.20% 48.50% 0.00% 1.24% NA
VI/Aromatic  96 1.00% 93.80% 1.04% 4.17% NA
Intermediate  90 25.60% 40.00% 0.00% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902278490 T -> G LOC_Os09g04290.1 upstream_gene_variant ; 3098.0bp to feature; MODIFIER silent_mutation Average:57.656; most accessible tissue: Zhenshan97 flag leaf, score: 94.888 N N N N
vg0902278490 T -> G LOC_Os09g04290.2 upstream_gene_variant ; 3098.0bp to feature; MODIFIER silent_mutation Average:57.656; most accessible tissue: Zhenshan97 flag leaf, score: 94.888 N N N N
vg0902278490 T -> G LOC_Os09g04280.1 intron_variant ; MODIFIER silent_mutation Average:57.656; most accessible tissue: Zhenshan97 flag leaf, score: 94.888 N N N N
vg0902278490 T -> DEL N N silent_mutation Average:57.656; most accessible tissue: Zhenshan97 flag leaf, score: 94.888 N N N N
vg0902278490 T -> TGGC LOC_Os09g04290.1 upstream_gene_variant ; 3097.0bp to feature; MODIFIER silent_mutation Average:57.656; most accessible tissue: Zhenshan97 flag leaf, score: 94.888 N N N N
vg0902278490 T -> TGGC LOC_Os09g04290.2 upstream_gene_variant ; 3097.0bp to feature; MODIFIER silent_mutation Average:57.656; most accessible tissue: Zhenshan97 flag leaf, score: 94.888 N N N N
vg0902278490 T -> TGGC LOC_Os09g04280.1 intron_variant ; MODIFIER silent_mutation Average:57.656; most accessible tissue: Zhenshan97 flag leaf, score: 94.888 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0902278490 T G -0.02 -0.01 -0.01 -0.01 -0.02 -0.02
vg0902278490 T TGGC -0.15 -0.09 -0.07 -0.13 -0.12 -0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902278490 NA 2.28E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0902278490 NA 5.80E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 2.84E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 6.56E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 7.57E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 1.19E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 6.66E-06 1.91E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 4.48E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 4.49E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 1.10E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 2.73E-09 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 3.47E-06 3.09E-06 mr1648_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 6.63E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 1.86E-07 5.22E-09 mr1663_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 5.86E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 2.57E-06 2.57E-06 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 6.15E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 7.21E-07 NA mr1812_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 1.05E-06 NA mr1816_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 1.83E-06 NA mr1832_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 1.34E-06 NA mr1833_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 6.87E-06 6.87E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 7.90E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 3.56E-06 NA mr1843_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 2.37E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902278490 NA 5.39E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251