\
| Variant ID: vg0902272767 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 2272767 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.43, others allele: 0.00, population size: 49. )
TGAACATGATGATGCAACAACTCCAGAACCAACAAAACCAGGGGAACAATCATGCTCCTCCCCAGAACAAGTTAGCAGAATTTCTTCGTGTGAGGCCGCC[T/C]
ACTTTTTCCAGTACTACCAATCCAGTTGAGGCTGGTGATTGGCTACACGCCATAGAAAAGAAGTTGGACCTGCTTCAGTGCACTAACTAAGAAAAAGTCT
AGACTTTTTCTTAGTTAGTGCACTGAAGCAGGTCCAACTTCTTTTCTATGGCGTGTAGCCAATCACCAGCCTCAACTGGATTGGTAGTACTGGAAAAAGT[A/G]
GGCGGCCTCACACGAAGAAATTCTGCTAACTTGTTCTGGGGAGGAGCATGATTGTTCCCCTGGTTTTGTTGGTTCTGGAGTTGTTGCATCATCATGTTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.30% | 24.40% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 95.50% | 4.10% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 36.20% | 63.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 11.60% | 1.01% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 50.60% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 49.00% | 50.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902272767 | T -> DEL | N | N | silent_mutation | Average:31.247; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0902272767 | T -> C | LOC_Os09g04280.1 | downstream_gene_variant ; 3222.0bp to feature; MODIFIER | silent_mutation | Average:31.247; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0902272767 | T -> C | LOC_Os09g04270.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.247; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902272767 | 4.02E-06 | NA | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 1.52E-09 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 3.50E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | 7.31E-06 | 7.31E-06 | mr1537 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | 1.92E-06 | 1.92E-06 | mr1590 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 2.73E-07 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 2.35E-08 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 1.39E-06 | mr1964 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 1.53E-14 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 5.22E-07 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 2.84E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 5.79E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902272767 | NA | 6.57E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |