Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0902265544:

Variant ID: vg0902265544 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 2265544
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCTTAGATTCCGACGTTCTTGGAGAGTCCGATTTTGCAGGAGAAGACTTTGAAGAATTCCAAGGCTAGCAAGGCAAGTCACACAGATCCCAAACAACC[C/G]
TTGGAGCATGTTAATCCTGTTTAAAGCTATTGTTTCTATTCAACTATTGCATTTATTTTTGAATACATCGGGTGGAAATGACCTATTTCCTTTGTTATAG

Reverse complement sequence

CTATAACAAAGGAAATAGGTCATTTCCACCCGATGTATTCAAAAATAAATGCAATAGTTGAATAGAAACAATAGCTTTAAACAGGATTAACATGCTCCAA[G/C]
GGTTGTTTGGGATCTGTGTGACTTGCCTTGCTAGCCTTGGAATTCTTCAAAGTCTTCTCCTGCAAAATCGGACTCTCCAAGAACGTCGGAATCTAAGCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.30%	0.90%	5.56%	66.25%	NA
All Indica	2759	8.40%	1.40%	4.28%	85.86%	NA
All Japonica	1512	64.20%	0.00%	0.73%	35.12%	NA
Aus	269	2.60%	0.40%	46.47%	50.56%	NA
Indica I	595	17.60%	0.50%	1.51%	80.34%	NA
Indica II	465	11.60%	0.00%	4.73%	83.66%	NA
Indica III	913	0.90%	1.60%	4.05%	93.43%	NA
Indica Intermediate	786	8.30%	2.80%	6.36%	82.57%	NA
Temperate Japonica	767	97.50%	0.00%	0.00%	2.48%	NA
Tropical Japonica	504	19.60%	0.00%	1.79%	78.57%	NA
Japonica Intermediate	241	51.00%	0.00%	0.83%	48.13%	NA
VI/Aromatic	96	50.00%	0.00%	4.17%	45.83%	NA
Intermediate	90	37.80%	0.00%	5.56%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0902265544	C -> G	LOC_Os09g04270.1	upstream_gene_variant ; 891.0bp to feature; MODIFIER	silent_mutation	Average:28.325; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0902265544	C -> G	LOC_Os09g04260.1	downstream_gene_variant ; 3588.0bp to feature; MODIFIER	silent_mutation	Average:28.325; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0902265544	C -> G	LOC_Os09g04260-LOC_Os09g04270	intergenic_region ; MODIFIER	silent_mutation	Average:28.325; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0902265544	C -> DEL	N	N	silent_mutation	Average:28.325; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0902265544	NA	9.32E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902265544	5.17E-06	NA	mr1136_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251