Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902265202:

Variant ID: vg0902265202 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 2265202
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, G: 0.10, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGTTAGATCTCGGCCGTTCGTTTTGTTTAGATTAGATCTCAGCCGTTCGTTCCGTAGACCGCTTCTGTTCACTCGGTCCACCATGAACCCGAGCCCCG[C/G]
TGACGCAATAAATCCTTTTTCCGTTTCAAAAATAATTCTTTATTGCATCATAATCCAATTAAAATCTATATAAATGATTTAATCCGGTTTAATCTTTAAA

Reverse complement sequence

TTTAAAGATTAAACCGGATTAAATCATTTATATAGATTTTAATTGGATTATGATGCAATAAAGAATTATTTTTGAAACGGAAAAAGGATTTATTGCGTCA[G/C]
CGGGGCTCGGGTTCATGGTGGACCGAGTGAACAGAAGCGGTCTACGGAACGAACGGCTGAGATCTAATCTAAACAAAACGAACGGCCGAGATCTAACCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	26.30%	0.25%	12.84%	NA
All Indica	2759	91.60%	7.00%	0.18%	1.23%	NA
All Japonica	1512	1.40%	64.20%	0.46%	33.99%	NA
Aus	269	98.10%	1.50%	0.00%	0.37%	NA
Indica I	595	88.10%	11.10%	0.34%	0.50%	NA
Indica II	465	90.10%	9.70%	0.00%	0.22%	NA
Indica III	913	95.90%	2.30%	0.22%	1.53%	NA
Indica Intermediate	786	90.20%	7.60%	0.13%	2.04%	NA
Temperate Japonica	767	0.50%	97.30%	0.00%	2.22%	NA
Tropical Japonica	504	2.20%	20.00%	1.19%	76.59%	NA
Japonica Intermediate	241	2.50%	51.00%	0.41%	46.06%	NA
VI/Aromatic	96	7.30%	51.00%	0.00%	41.67%	NA
Intermediate	90	47.80%	32.20%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0902265202	C -> G	LOC_Os09g04270.1	upstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0902265202	C -> G	LOC_Os09g04260.1	downstream_gene_variant ; 3246.0bp to feature; MODIFIER	silent_mutation	Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0902265202	C -> G	LOC_Os09g04260-LOC_Os09g04270	intergenic_region ; MODIFIER	silent_mutation	Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0902265202	C -> DEL	N	N	silent_mutation	Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0902265202	NA	1.09E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902265202	NA	1.14E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902265202	NA	3.41E-08	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902265202	NA	8.37E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902265202	NA	7.75E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902265202	NA	1.64E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902265202	3.96E-07	NA	mr1136_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251