\
| Variant ID: vg0902265202 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 2265202 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, G: 0.10, others allele: 0.00, population size: 68. )
TCGGTTAGATCTCGGCCGTTCGTTTTGTTTAGATTAGATCTCAGCCGTTCGTTCCGTAGACCGCTTCTGTTCACTCGGTCCACCATGAACCCGAGCCCCG[C/G]
TGACGCAATAAATCCTTTTTCCGTTTCAAAAATAATTCTTTATTGCATCATAATCCAATTAAAATCTATATAAATGATTTAATCCGGTTTAATCTTTAAA
TTTAAAGATTAAACCGGATTAAATCATTTATATAGATTTTAATTGGATTATGATGCAATAAAGAATTATTTTTGAAACGGAAAAAGGATTTATTGCGTCA[G/C]
CGGGGCTCGGGTTCATGGTGGACCGAGTGAACAGAAGCGGTCTACGGAACGAACGGCTGAGATCTAATCTAAACAAAACGAACGGCCGAGATCTAACCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 26.30% | 0.25% | 12.84% | NA |
| All Indica | 2759 | 91.60% | 7.00% | 0.18% | 1.23% | NA |
| All Japonica | 1512 | 1.40% | 64.20% | 0.46% | 33.99% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 88.10% | 11.10% | 0.34% | 0.50% | NA |
| Indica II | 465 | 90.10% | 9.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 95.90% | 2.30% | 0.22% | 1.53% | NA |
| Indica Intermediate | 786 | 90.20% | 7.60% | 0.13% | 2.04% | NA |
| Temperate Japonica | 767 | 0.50% | 97.30% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 2.20% | 20.00% | 1.19% | 76.59% | NA |
| Japonica Intermediate | 241 | 2.50% | 51.00% | 0.41% | 46.06% | NA |
| VI/Aromatic | 96 | 7.30% | 51.00% | 0.00% | 41.67% | NA |
| Intermediate | 90 | 47.80% | 32.20% | 0.00% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902265202 | C -> G | LOC_Os09g04270.1 | upstream_gene_variant ; 1233.0bp to feature; MODIFIER | silent_mutation | Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0902265202 | C -> G | LOC_Os09g04260.1 | downstream_gene_variant ; 3246.0bp to feature; MODIFIER | silent_mutation | Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0902265202 | C -> G | LOC_Os09g04260-LOC_Os09g04270 | intergenic_region ; MODIFIER | silent_mutation | Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0902265202 | C -> DEL | N | N | silent_mutation | Average:40.134; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902265202 | NA | 1.09E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902265202 | NA | 1.14E-08 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902265202 | NA | 3.41E-08 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902265202 | NA | 8.37E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902265202 | NA | 7.75E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902265202 | NA | 1.64E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902265202 | 3.96E-07 | NA | mr1136_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |