Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902251270:

Variant ID: vg0902251270 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 2251270
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGAATTTATTAATTAAAACTAGATCTTCTCTTCTAGGCTTTTAAAATAAATTCTAATAATTCCAATTTAGACAACAATTTATATATTTGGGATTTTTA[G/T]
GGTGTGACAGCGGGAGCAAGTAGGTCTAGTAGAAATCCCCGGTCACAAAATATATGGCCGACCACAGTGCAAGTTATAAGAGAGGTTGACGCTAGTGGTA

Reverse complement sequence

TACCACTAGCGTCAACCTCTCTTATAACTTGCACTGTGGTCGGCCATATATTTTGTGACCGGGGATTTCTACTAGACCTACTTGCTCCCGCTGTCACACC[C/A]
TAAAAATCCCAAATATATAAATTGTTGTCTAAATTGGAATTATTAGAATTTATTTTAAAAGCCTAGAAGAGAAGATCTAGTTTTAATTAATAAATTCCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	33.30%	0.15%	12.65%	NA
All Indica	2759	88.10%	11.10%	0.11%	0.69%	NA
All Japonica	1512	1.30%	64.20%	0.07%	34.52%	NA
Aus	269	17.80%	81.80%	0.00%	0.37%	NA
Indica I	595	89.10%	10.40%	0.00%	0.50%	NA
Indica II	465	84.10%	15.30%	0.43%	0.22%	NA
Indica III	913	93.50%	5.70%	0.00%	0.77%	NA
Indica Intermediate	786	83.60%	15.30%	0.13%	1.02%	NA
Temperate Japonica	767	0.50%	97.30%	0.00%	2.22%	NA
Tropical Japonica	504	2.00%	20.00%	0.20%	77.78%	NA
Japonica Intermediate	241	2.10%	51.00%	0.00%	46.89%	NA
VI/Aromatic	96	5.20%	53.10%	0.00%	41.67%	NA
Intermediate	90	47.80%	31.10%	3.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0902251270	G -> DEL	N	N	silent_mutation	Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0902251270	G -> T	LOC_Os09g04250.1	upstream_gene_variant ; 1137.0bp to feature; MODIFIER	silent_mutation	Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0902251270	G -> T	LOC_Os09g04260.1	upstream_gene_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0902251270	G -> T	LOC_Os09g04250-LOC_Os09g04260	intergenic_region ; MODIFIER	silent_mutation	Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0902251270	NA	7.32E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0902251270	NA	3.54E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270	NA	1.50E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270	NA	2.32E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270	1.71E-07	1.62E-37	mr1208_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270	NA	1.33E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270	NA	1.58E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270	NA	2.81E-09	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270	NA	2.09E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251