\
| Variant ID: vg0902251270 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 2251270 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.09, others allele: 0.00, population size: 82. )
TTGGAATTTATTAATTAAAACTAGATCTTCTCTTCTAGGCTTTTAAAATAAATTCTAATAATTCCAATTTAGACAACAATTTATATATTTGGGATTTTTA[G/T]
GGTGTGACAGCGGGAGCAAGTAGGTCTAGTAGAAATCCCCGGTCACAAAATATATGGCCGACCACAGTGCAAGTTATAAGAGAGGTTGACGCTAGTGGTA
TACCACTAGCGTCAACCTCTCTTATAACTTGCACTGTGGTCGGCCATATATTTTGTGACCGGGGATTTCTACTAGACCTACTTGCTCCCGCTGTCACACC[C/A]
TAAAAATCCCAAATATATAAATTGTTGTCTAAATTGGAATTATTAGAATTTATTTTAAAAGCCTAGAAGAGAAGATCTAGTTTTAATTAATAAATTCCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.90% | 33.30% | 0.15% | 12.65% | NA |
| All Indica | 2759 | 88.10% | 11.10% | 0.11% | 0.69% | NA |
| All Japonica | 1512 | 1.30% | 64.20% | 0.07% | 34.52% | NA |
| Aus | 269 | 17.80% | 81.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 89.10% | 10.40% | 0.00% | 0.50% | NA |
| Indica II | 465 | 84.10% | 15.30% | 0.43% | 0.22% | NA |
| Indica III | 913 | 93.50% | 5.70% | 0.00% | 0.77% | NA |
| Indica Intermediate | 786 | 83.60% | 15.30% | 0.13% | 1.02% | NA |
| Temperate Japonica | 767 | 0.50% | 97.30% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 2.00% | 20.00% | 0.20% | 77.78% | NA |
| Japonica Intermediate | 241 | 2.10% | 51.00% | 0.00% | 46.89% | NA |
| VI/Aromatic | 96 | 5.20% | 53.10% | 0.00% | 41.67% | NA |
| Intermediate | 90 | 47.80% | 31.10% | 3.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902251270 | G -> DEL | N | N | silent_mutation | Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0902251270 | G -> T | LOC_Os09g04250.1 | upstream_gene_variant ; 1137.0bp to feature; MODIFIER | silent_mutation | Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0902251270 | G -> T | LOC_Os09g04260.1 | upstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0902251270 | G -> T | LOC_Os09g04250-LOC_Os09g04260 | intergenic_region ; MODIFIER | silent_mutation | Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902251270 | NA | 7.32E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0902251270 | NA | 3.54E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902251270 | NA | 1.50E-07 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902251270 | NA | 2.32E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902251270 | 1.71E-07 | 1.62E-37 | mr1208_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902251270 | NA | 1.33E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902251270 | NA | 1.58E-09 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902251270 | NA | 2.81E-09 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902251270 | NA | 2.09E-09 | mr1864_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |