\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902251270:

Variant ID: vg0902251270 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 2251270
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGAATTTATTAATTAAAACTAGATCTTCTCTTCTAGGCTTTTAAAATAAATTCTAATAATTCCAATTTAGACAACAATTTATATATTTGGGATTTTTA[G/T]
GGTGTGACAGCGGGAGCAAGTAGGTCTAGTAGAAATCCCCGGTCACAAAATATATGGCCGACCACAGTGCAAGTTATAAGAGAGGTTGACGCTAGTGGTA

Reverse complement sequence

TACCACTAGCGTCAACCTCTCTTATAACTTGCACTGTGGTCGGCCATATATTTTGTGACCGGGGATTTCTACTAGACCTACTTGCTCCCGCTGTCACACC[C/A]
TAAAAATCCCAAATATATAAATTGTTGTCTAAATTGGAATTATTAGAATTTATTTTAAAAGCCTAGAAGAGAAGATCTAGTTTTAATTAATAAATTCCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 33.30% 0.15% 12.65% NA
All Indica  2759 88.10% 11.10% 0.11% 0.69% NA
All Japonica  1512 1.30% 64.20% 0.07% 34.52% NA
Aus  269 17.80% 81.80% 0.00% 0.37% NA
Indica I  595 89.10% 10.40% 0.00% 0.50% NA
Indica II  465 84.10% 15.30% 0.43% 0.22% NA
Indica III  913 93.50% 5.70% 0.00% 0.77% NA
Indica Intermediate  786 83.60% 15.30% 0.13% 1.02% NA
Temperate Japonica  767 0.50% 97.30% 0.00% 2.22% NA
Tropical Japonica  504 2.00% 20.00% 0.20% 77.78% NA
Japonica Intermediate  241 2.10% 51.00% 0.00% 46.89% NA
VI/Aromatic  96 5.20% 53.10% 0.00% 41.67% NA
Intermediate  90 47.80% 31.10% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902251270 G -> DEL N N silent_mutation Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0902251270 G -> T LOC_Os09g04250.1 upstream_gene_variant ; 1137.0bp to feature; MODIFIER silent_mutation Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0902251270 G -> T LOC_Os09g04260.1 upstream_gene_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0902251270 G -> T LOC_Os09g04250-LOC_Os09g04260 intergenic_region ; MODIFIER silent_mutation Average:41.649; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902251270 NA 7.32E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0902251270 NA 3.54E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270 NA 1.50E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270 NA 2.32E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270 1.71E-07 1.62E-37 mr1208_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270 NA 1.33E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270 NA 1.58E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270 NA 2.81E-09 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902251270 NA 2.09E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251