\
| Variant ID: vg0902208073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 2208073 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )
TGAATTGAATCTCTAATTGCAGTTAATATAAATAGTATATTAAATCTCTCATTGTTTCTCATGTAGTGTGCAAAGCAGGACCAGGGAACTAACTTATGCG[A/G]
CTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCGATGTACGTATACATAAACCATTCAAAATTTCATTGCTC
GAGCAATGAAATTTTGAATGGTTTATGTATACGTACATCGAGCTCTCGTGTTGTGCATATTTGGTTTGATAGGCAGTGGGCATACTCGCATACGTAGTAG[T/C]
CGCATAAGTTAGTTCCCTGGTCCTGCTTTGCACACTACATGAGAAACAATGAGAGATTTAATATACTATTTATATTAACTGCAATTAGAGATTCAATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 10.40% | 2.07% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 0.30% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 64.90% | 31.30% | 3.77% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.90% | 0.40% | 6.67% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 0.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 38.20% | 55.80% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 15.80% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902208073 | A -> G | LOC_Os09g04200.1 | missense_variant ; p.Asp117Gly; MODERATE | nonsynonymous_codon ; D117G | Average:32.233; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | benign |
-0.483 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902208073 | NA | 2.28E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 3.68E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 1.38E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 1.31E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 1.14E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 1.78E-07 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | 8.30E-06 | 5.04E-10 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 1.23E-08 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 8.01E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 4.89E-08 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 2.91E-06 | mr1555_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | 1.98E-07 | 1.92E-09 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 8.95E-09 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 2.82E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 4.97E-08 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 5.89E-06 | mr1763_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | 1.12E-07 | 1.71E-12 | mr1880_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902208073 | NA | 6.86E-11 | mr1880_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |