\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902200100:

Variant ID: vg0902200100 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 2200100
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTGGGATAACTTATGACTCATTATTTAATGATGGTTTAATGATAGTTCACGATGGTTAATCGTGATTGGTTAATTAATTACTTGCCAACTAAAATTT[A/G]
ATAATGGTGGGTTGTGAGCACATGGTTTTGAGAGTCGTGCTCATGACAATTAAGGACCGGTTCGCGAGCTTCTATTGTGAAACATTAACCGTGCCAACCA

Reverse complement sequence

TGGTTGGCACGGTTAATGTTTCACAATAGAAGCTCGCGAACCGGTCCTTAATTGTCATGAGCACGACTCTCAAAACCATGTGCTCACAACCCACCATTAT[T/C]
AAATTTTAGTTGGCAAGTAATTAATTAACCAATCACGATTAACCATCGTGAACTATCATTAAACCATCATTAAATAATGAGTCATAAGTTATCCCAATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.70% 0.30% 35.91% 41.16% NA
All Indica  2759 3.00% 0.10% 44.00% 52.88% NA
All Japonica  1512 64.00% 0.00% 9.39% 26.65% NA
Aus  269 0.40% 2.20% 95.54% 1.86% NA
Indica I  595 5.50% 0.00% 32.77% 61.68% NA
Indica II  465 2.80% 0.00% 50.75% 46.45% NA
Indica III  913 1.00% 0.00% 41.51% 57.50% NA
Indica Intermediate  786 3.40% 0.50% 51.40% 44.66% NA
Temperate Japonica  767 96.90% 0.00% 0.91% 2.22% NA
Tropical Japonica  504 20.20% 0.00% 21.03% 58.73% NA
Japonica Intermediate  241 50.60% 0.00% 12.03% 37.34% NA
VI/Aromatic  96 1.00% 3.10% 56.25% 39.58% NA
Intermediate  90 22.20% 0.00% 33.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902200100 A -> G LOC_Os09g04170.1 downstream_gene_variant ; 2356.0bp to feature; MODIFIER silent_mutation Average:38.76; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0902200100 A -> G LOC_Os09g04170-LOC_Os09g04190 intergenic_region ; MODIFIER silent_mutation Average:38.76; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0902200100 A -> DEL N N silent_mutation Average:38.76; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902200100 NA 3.56E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0902200100 NA 1.29E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0902200100 NA 1.49E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902200100 NA 4.32E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902200100 NA 6.15E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902200100 NA 4.19E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902200100 NA 5.23E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902200100 NA 2.49E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902200100 NA 3.80E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902200100 3.12E-06 9.87E-07 mr1636_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251