\
| Variant ID: vg0902200100 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 2200100 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 78. )
CTATTGGGATAACTTATGACTCATTATTTAATGATGGTTTAATGATAGTTCACGATGGTTAATCGTGATTGGTTAATTAATTACTTGCCAACTAAAATTT[A/G]
ATAATGGTGGGTTGTGAGCACATGGTTTTGAGAGTCGTGCTCATGACAATTAAGGACCGGTTCGCGAGCTTCTATTGTGAAACATTAACCGTGCCAACCA
TGGTTGGCACGGTTAATGTTTCACAATAGAAGCTCGCGAACCGGTCCTTAATTGTCATGAGCACGACTCTCAAAACCATGTGCTCACAACCCACCATTAT[T/C]
AAATTTTAGTTGGCAAGTAATTAATTAACCAATCACGATTAACCATCGTGAACTATCATTAAACCATCATTAAATAATGAGTCATAAGTTATCCCAATAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.70% | 0.30% | 35.91% | 41.16% | NA |
| All Indica | 2759 | 3.00% | 0.10% | 44.00% | 52.88% | NA |
| All Japonica | 1512 | 64.00% | 0.00% | 9.39% | 26.65% | NA |
| Aus | 269 | 0.40% | 2.20% | 95.54% | 1.86% | NA |
| Indica I | 595 | 5.50% | 0.00% | 32.77% | 61.68% | NA |
| Indica II | 465 | 2.80% | 0.00% | 50.75% | 46.45% | NA |
| Indica III | 913 | 1.00% | 0.00% | 41.51% | 57.50% | NA |
| Indica Intermediate | 786 | 3.40% | 0.50% | 51.40% | 44.66% | NA |
| Temperate Japonica | 767 | 96.90% | 0.00% | 0.91% | 2.22% | NA |
| Tropical Japonica | 504 | 20.20% | 0.00% | 21.03% | 58.73% | NA |
| Japonica Intermediate | 241 | 50.60% | 0.00% | 12.03% | 37.34% | NA |
| VI/Aromatic | 96 | 1.00% | 3.10% | 56.25% | 39.58% | NA |
| Intermediate | 90 | 22.20% | 0.00% | 33.33% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902200100 | A -> G | LOC_Os09g04170.1 | downstream_gene_variant ; 2356.0bp to feature; MODIFIER | silent_mutation | Average:38.76; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0902200100 | A -> G | LOC_Os09g04170-LOC_Os09g04190 | intergenic_region ; MODIFIER | silent_mutation | Average:38.76; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0902200100 | A -> DEL | N | N | silent_mutation | Average:38.76; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902200100 | NA | 3.56E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0902200100 | NA | 1.29E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0902200100 | NA | 1.49E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902200100 | NA | 4.32E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902200100 | NA | 6.15E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902200100 | NA | 4.19E-09 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902200100 | NA | 5.23E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902200100 | NA | 2.49E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902200100 | NA | 3.80E-08 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902200100 | 3.12E-06 | 9.87E-07 | mr1636_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |