\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902154424:

Variant ID: vg0902154424 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 2154424
Reference Allele: AAlternative Allele: G,T,AG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAAAATTATTTCTTGAGCTCCGAAAATTCACGGGAAATTTCAGAGAGTATTTTAGGGCACAAAGAATATTGCAAAATATTCCCGGCCAATGATTTTTA[A/G,T,AG]
GGAAAAATTTAATTCTCCCATTAATTCACTCGAATAAATTGCTTAACTTTTTATTTAATTTCTAGGTAATGCATTATTAAATGATTTTTAATCCCGAACG

Reverse complement sequence

CGTTCGGGATTAAAAATCATTTAATAATGCATTACCTAGAAATTAAATAAAAAGTTAAGCAATTTATTCGAGTGAATTAATGGGAGAATTAAATTTTTCC[T/C,A,CT]
TAAAAATCATTGGCCGGGAATATTTTGCAATATTCTTTGTGCCCTAAAATACTCTCTGAAATTTCCCGTGAATTTTCGGAGCTCAAGAAATAATTTTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 22.30% 2.81% 0.00% AG: 13.92%; T: 1.65%
All Indica  2759 90.70% 2.40% 3.48% 0.00% T: 2.46%; AG: 0.91%
All Japonica  1512 0.80% 63.90% 0.07% 0.00% AG: 35.25%
Aus  269 90.70% 0.70% 4.83% 0.00% T: 3.35%; AG: 0.37%
Indica I  595 89.60% 4.90% 3.19% 0.00% T: 1.68%; AG: 0.67%
Indica II  465 85.60% 2.20% 8.82% 0.00% T: 3.23%; AG: 0.22%
Indica III  913 94.90% 0.40% 1.20% 0.00% T: 2.63%; AG: 0.88%
Indica Intermediate  786 89.80% 3.10% 3.18% 0.00% T: 2.42%; AG: 1.53%
Temperate Japonica  767 0.50% 97.00% 0.13% 0.00% AG: 2.35%
Tropical Japonica  504 1.00% 19.60% 0.00% 0.00% AG: 79.37%
Japonica Intermediate  241 1.20% 51.00% 0.00% 0.00% AG: 47.72%
VI/Aromatic  96 6.20% 3.10% 19.79% 0.00% AG: 70.83%
Intermediate  90 41.10% 18.90% 4.44% 0.00% AG: 34.44%; T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902154424 A -> G LOC_Os09g04150.1 downstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0902154424 A -> G LOC_Os09g04140-LOC_Os09g04150 intergenic_region ; MODIFIER silent_mutation Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0902154424 A -> T LOC_Os09g04150.1 downstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0902154424 A -> T LOC_Os09g04140-LOC_Os09g04150 intergenic_region ; MODIFIER silent_mutation Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0902154424 A -> AG LOC_Os09g04150.1 downstream_gene_variant ; 2087.0bp to feature; MODIFIER silent_mutation Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0902154424 A -> AG LOC_Os09g04140-LOC_Os09g04150 intergenic_region ; MODIFIER silent_mutation Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902154424 2.12E-06 NA mr1610 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902154424 3.62E-06 NA mr1928 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902154424 1.35E-06 2.08E-06 mr1928 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251