\
| Variant ID: vg0902154424 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 2154424 |
| Reference Allele: A | Alternative Allele: G,T,AG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )
TTGAAAATTATTTCTTGAGCTCCGAAAATTCACGGGAAATTTCAGAGAGTATTTTAGGGCACAAAGAATATTGCAAAATATTCCCGGCCAATGATTTTTA[A/G,T,AG]
GGAAAAATTTAATTCTCCCATTAATTCACTCGAATAAATTGCTTAACTTTTTATTTAATTTCTAGGTAATGCATTATTAAATGATTTTTAATCCCGAACG
CGTTCGGGATTAAAAATCATTTAATAATGCATTACCTAGAAATTAAATAAAAAGTTAAGCAATTTATTCGAGTGAATTAATGGGAGAATTAAATTTTTCC[T/C,A,CT]
TAAAAATCATTGGCCGGGAATATTTTGCAATATTCTTTGTGCCCTAAAATACTCTCTGAAATTTCCCGTGAATTTTCGGAGCTCAAGAAATAATTTTCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.30% | 22.30% | 2.81% | 0.00% | AG: 13.92%; T: 1.65% |
| All Indica | 2759 | 90.70% | 2.40% | 3.48% | 0.00% | T: 2.46%; AG: 0.91% |
| All Japonica | 1512 | 0.80% | 63.90% | 0.07% | 0.00% | AG: 35.25% |
| Aus | 269 | 90.70% | 0.70% | 4.83% | 0.00% | T: 3.35%; AG: 0.37% |
| Indica I | 595 | 89.60% | 4.90% | 3.19% | 0.00% | T: 1.68%; AG: 0.67% |
| Indica II | 465 | 85.60% | 2.20% | 8.82% | 0.00% | T: 3.23%; AG: 0.22% |
| Indica III | 913 | 94.90% | 0.40% | 1.20% | 0.00% | T: 2.63%; AG: 0.88% |
| Indica Intermediate | 786 | 89.80% | 3.10% | 3.18% | 0.00% | T: 2.42%; AG: 1.53% |
| Temperate Japonica | 767 | 0.50% | 97.00% | 0.13% | 0.00% | AG: 2.35% |
| Tropical Japonica | 504 | 1.00% | 19.60% | 0.00% | 0.00% | AG: 79.37% |
| Japonica Intermediate | 241 | 1.20% | 51.00% | 0.00% | 0.00% | AG: 47.72% |
| VI/Aromatic | 96 | 6.20% | 3.10% | 19.79% | 0.00% | AG: 70.83% |
| Intermediate | 90 | 41.10% | 18.90% | 4.44% | 0.00% | AG: 34.44%; T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902154424 | A -> G | LOC_Os09g04150.1 | downstream_gene_variant ; 2088.0bp to feature; MODIFIER | silent_mutation | Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0902154424 | A -> G | LOC_Os09g04140-LOC_Os09g04150 | intergenic_region ; MODIFIER | silent_mutation | Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0902154424 | A -> T | LOC_Os09g04150.1 | downstream_gene_variant ; 2088.0bp to feature; MODIFIER | silent_mutation | Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0902154424 | A -> T | LOC_Os09g04140-LOC_Os09g04150 | intergenic_region ; MODIFIER | silent_mutation | Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0902154424 | A -> AG | LOC_Os09g04150.1 | downstream_gene_variant ; 2087.0bp to feature; MODIFIER | silent_mutation | Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0902154424 | A -> AG | LOC_Os09g04140-LOC_Os09g04150 | intergenic_region ; MODIFIER | silent_mutation | Average:25.462; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902154424 | 2.12E-06 | NA | mr1610 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902154424 | 3.62E-06 | NA | mr1928 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902154424 | 1.35E-06 | 2.08E-06 | mr1928 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |