\
| Variant ID: vg0902098917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 2098917 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTCTCACATTAATCAAAAGAAAATAAGAGAAATAGAAAAATCGAAGGAGATTAGGATTAGGTAGAAACGAAAAAGAAAGAAAGAAAACATCTCATGACA[C/T]
GGGAAAACGGACAAGGTCTCTGAAATAAGTGTGAACTGGGTACTCCTATAAACTAAATGTAATCAATCAGTACTTGTCATGCCAATAAATACATCTCATA
TATGAGATGTATTTATTGGCATGACAAGTACTGATTGATTACATTTAGTTTATAGGAGTACCCAGTTCACACTTATTTCAGAGACCTTGTCCGTTTTCCC[G/A]
TGTCATGAGATGTTTTCTTTCTTTCTTTTTCGTTTCTACCTAATCCTAATCTCCTTCGATTTTTCTATTTCTCTTATTTTCTTTTGATTAATGTGAGAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.80% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.90% | 5.80% | 0.26% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 83.50% | 15.90% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0902098917 | C -> T | LOC_Os09g04070.1 | upstream_gene_variant ; 1656.0bp to feature; MODIFIER | silent_mutation | Average:46.873; most accessible tissue: Minghui63 root, score: 84.447 | N | N | N | N |
| vg0902098917 | C -> T | LOC_Os09g04060.1 | downstream_gene_variant ; 3121.0bp to feature; MODIFIER | silent_mutation | Average:46.873; most accessible tissue: Minghui63 root, score: 84.447 | N | N | N | N |
| vg0902098917 | C -> T | LOC_Os09g04060-LOC_Os09g04070 | intergenic_region ; MODIFIER | silent_mutation | Average:46.873; most accessible tissue: Minghui63 root, score: 84.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0902098917 | 9.46E-07 | 9.46E-07 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902098917 | NA | 4.10E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902098917 | NA | 7.94E-07 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902098917 | 3.72E-06 | NA | mr1233 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0902098917 | NA | 9.38E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |