\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902098917:

Variant ID: vg0902098917 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 2098917
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCTCACATTAATCAAAAGAAAATAAGAGAAATAGAAAAATCGAAGGAGATTAGGATTAGGTAGAAACGAAAAAGAAAGAAAGAAAACATCTCATGACA[C/T]
GGGAAAACGGACAAGGTCTCTGAAATAAGTGTGAACTGGGTACTCCTATAAACTAAATGTAATCAATCAGTACTTGTCATGCCAATAAATACATCTCATA

Reverse complement sequence

TATGAGATGTATTTATTGGCATGACAAGTACTGATTGATTACATTTAGTTTATAGGAGTACCCAGTTCACACTTATTTCAGAGACCTTGTCCGTTTTCCC[G/A]
TGTCATGAGATGTTTTCTTTCTTTCTTTTTCGTTTCTACCTAATCCTAATCTCCTTCGATTTTTCTATTTCTCTTATTTTCTTTTGATTAATGTGAGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 3.80% 0.08% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 93.90% 5.80% 0.26% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 83.50% 15.90% 0.60% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902098917 C -> T LOC_Os09g04070.1 upstream_gene_variant ; 1656.0bp to feature; MODIFIER silent_mutation Average:46.873; most accessible tissue: Minghui63 root, score: 84.447 N N N N
vg0902098917 C -> T LOC_Os09g04060.1 downstream_gene_variant ; 3121.0bp to feature; MODIFIER silent_mutation Average:46.873; most accessible tissue: Minghui63 root, score: 84.447 N N N N
vg0902098917 C -> T LOC_Os09g04060-LOC_Os09g04070 intergenic_region ; MODIFIER silent_mutation Average:46.873; most accessible tissue: Minghui63 root, score: 84.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902098917 9.46E-07 9.46E-07 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902098917 NA 4.10E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902098917 NA 7.94E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902098917 3.72E-06 NA mr1233 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902098917 NA 9.38E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251