Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901940944:

Variant ID: vg0901940944 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1940944
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGATTCTCGAAAGGTAAAGCTCCGCCAACCTTTTGCCCGTATATGTGGTATGTACTGGTATGAAGTGAGAAACCTTAGTGAGTCGATCCACGACTACC[T/C]
AGATTGAATCGTGACCCGATGATGTCCGGGGCAGTCCTGTTATAAAGTCCATTCCAATCTCTTCCCATTTCCATTCCGGGATTTGAAGAGGTTGGAGTAA

Reverse complement sequence

TTACTCCAACCTCTTCAAATCCCGGAATGGAAATGGGAAGAGATTGGAATGGACTTTATAACAGGACTGCCCCGGACATCATCGGGTCACGATTCAATCT[A/G]
GGTAGTCGTGGATCGACTCACTAAGGTTTCTCACTTCATACCAGTACATACCACATATACGGGCAAAAGGTTGGCGGAGCTTTACCTTTCGAGAATCATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.70%	8.10%	42.15%	2.07%	NA
All Indica	2759	42.40%	12.30%	45.16%	0.22%	NA
All Japonica	1512	65.70%	0.50%	28.37%	5.42%	NA
Aus	269	12.30%	8.90%	78.81%	0.00%	NA
Indica I	595	36.10%	15.30%	48.24%	0.34%	NA
Indica II	465	42.80%	10.30%	46.45%	0.43%	NA
Indica III	913	47.00%	12.30%	40.74%	0.00%	NA
Indica Intermediate	786	41.50%	11.10%	47.20%	0.25%	NA
Temperate Japonica	767	97.10%	0.00%	1.83%	1.04%	NA
Tropical Japonica	504	24.20%	1.20%	64.88%	9.72%	NA
Japonica Intermediate	241	52.30%	0.80%	36.51%	10.37%	NA
VI/Aromatic	96	14.60%	6.20%	71.88%	7.29%	NA
Intermediate	90	47.80%	8.90%	40.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901940944	T -> DEL	N	N	silent_mutation	Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0901940944	T -> C	LOC_Os09g03820.1	downstream_gene_variant ; 1870.0bp to feature; MODIFIER	silent_mutation	Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0901940944	T -> C	LOC_Os09g03840.1	downstream_gene_variant ; 3795.0bp to feature; MODIFIER	silent_mutation	Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0901940944	T -> C	LOC_Os09g03830.1	intron_variant ; MODIFIER	silent_mutation	Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901940944	NA	3.42E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901940944	NA	7.03E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901940944	NA	7.14E-06	mr1157	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	4.12E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	1.37E-07	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	4.08E-06	9.66E-08	mr1446	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	2.11E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	1.16E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	1.79E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	5.25E-06	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	7.87E-12	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	4.17E-11	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	2.18E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	1.52E-08	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	1.02E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944	NA	5.01E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251