\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901940944:

Variant ID: vg0901940944 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1940944
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGATTCTCGAAAGGTAAAGCTCCGCCAACCTTTTGCCCGTATATGTGGTATGTACTGGTATGAAGTGAGAAACCTTAGTGAGTCGATCCACGACTACC[T/C]
AGATTGAATCGTGACCCGATGATGTCCGGGGCAGTCCTGTTATAAAGTCCATTCCAATCTCTTCCCATTTCCATTCCGGGATTTGAAGAGGTTGGAGTAA

Reverse complement sequence

TTACTCCAACCTCTTCAAATCCCGGAATGGAAATGGGAAGAGATTGGAATGGACTTTATAACAGGACTGCCCCGGACATCATCGGGTCACGATTCAATCT[A/G]
GGTAGTCGTGGATCGACTCACTAAGGTTTCTCACTTCATACCAGTACATACCACATATACGGGCAAAAGGTTGGCGGAGCTTTACCTTTCGAGAATCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.70% 8.10% 42.15% 2.07% NA
All Indica  2759 42.40% 12.30% 45.16% 0.22% NA
All Japonica  1512 65.70% 0.50% 28.37% 5.42% NA
Aus  269 12.30% 8.90% 78.81% 0.00% NA
Indica I  595 36.10% 15.30% 48.24% 0.34% NA
Indica II  465 42.80% 10.30% 46.45% 0.43% NA
Indica III  913 47.00% 12.30% 40.74% 0.00% NA
Indica Intermediate  786 41.50% 11.10% 47.20% 0.25% NA
Temperate Japonica  767 97.10% 0.00% 1.83% 1.04% NA
Tropical Japonica  504 24.20% 1.20% 64.88% 9.72% NA
Japonica Intermediate  241 52.30% 0.80% 36.51% 10.37% NA
VI/Aromatic  96 14.60% 6.20% 71.88% 7.29% NA
Intermediate  90 47.80% 8.90% 40.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901940944 T -> DEL N N silent_mutation Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0901940944 T -> C LOC_Os09g03820.1 downstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0901940944 T -> C LOC_Os09g03840.1 downstream_gene_variant ; 3795.0bp to feature; MODIFIER silent_mutation Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0901940944 T -> C LOC_Os09g03830.1 intron_variant ; MODIFIER silent_mutation Average:24.822; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901940944 NA 3.42E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901940944 NA 7.03E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901940944 NA 7.14E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 4.12E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 1.37E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 4.08E-06 9.66E-08 mr1446 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 2.11E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 1.16E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 1.79E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 5.25E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 7.87E-12 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 4.17E-11 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 2.18E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 1.52E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 1.02E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901940944 NA 5.01E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251