\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901852241:

Variant ID: vg0901852241 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1852241
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATATAAAATGAGCTAATTATATATGTTGATATTTGTTTCTATTAGAAGTTGAGTTGGTTTTCGTGTTATGAGAAAAATTTGTTTCCGTATTCGTGTC[C/T]
GATCATATTCGATTATTACTCGTATTAGAGATAATCTATATTTGTTTCCATATTCGAGCTGTCTGTATTTGTTTCCGTGTCCGGCAAAAAATATGAAAAC

Reverse complement sequence

GTTTTCATATTTTTTGCCGGACACGGAAACAAATACAGACAGCTCGAATATGGAAACAAATATAGATTATCTCTAATACGAGTAATAATCGAATATGATC[G/A]
GACACGAATACGGAAACAAATTTTTCTCATAACACGAAAACCAACTCAACTTCTAATAGAAACAAATATCAACATATATAATTAGCTCATTTTATATAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.20% 0.15% 0.00% NA
All Indica  2759 68.90% 31.10% 0.00% 0.00% NA
All Japonica  1512 64.90% 35.00% 0.13% 0.00% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 65.70% 34.30% 0.00% 0.00% NA
Indica II  465 65.40% 34.60% 0.00% 0.00% NA
Indica III  913 81.90% 18.10% 0.00% 0.00% NA
Indica Intermediate  786 58.10% 41.90% 0.00% 0.00% NA
Temperate Japonica  767 97.10% 2.90% 0.00% 0.00% NA
Tropical Japonica  504 22.20% 77.60% 0.20% 0.00% NA
Japonica Intermediate  241 51.50% 48.10% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 92.70% 2.08% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901852241 C -> T LOC_Os09g03680.1 intron_variant ; MODIFIER silent_mutation Average:40.703; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901852241 NA 3.16E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901852241 NA 1.69E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901852241 3.90E-07 NA mr1208 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901852241 NA 6.56E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901852241 NA 2.04E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901852241 2.82E-08 NA mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901852241 NA 5.11E-07 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901852241 NA 1.49E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901852241 NA 4.46E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251