\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901762072:

Variant ID: vg0901762072 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1762072
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GACAGAGTGGACTGGCAAGCTATCTTACGGTTATGTCTTGCGCTCACTACTCGACATTTCGGTTATTATAACAGAAGGTTGTCAACCGCGATCATGGACA[T/C]
ATTGAGGACGAGTGGCTATTTGTGCATGTATGGATCCCACTTCTCCAATAGTATGTGGTGGTCGCGTTGGACACTGGATGGTATAATACTCGGGGTGTCC

Reverse complement sequence

GGACACCCCGAGTATTATACCATCCAGTGTCCAACGCGACCACCACATACTATTGGAGAAGTGGGATCCATACATGCACAAATAGCCACTCGTCCTCAAT[A/G]
TGTCCATGATCGCGGTTGACAACCTTCTGTTATAATAACCGAAATGTCGAGTAGTGAGCGCAAGACATAACCGTAAGATAGCTTGCCAGTCCACTCTGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 9.90% 1.38% 0.00% NA
All Indica  2759 99.70% 0.10% 0.14% 0.00% NA
All Japonica  1512 65.90% 30.20% 3.90% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.30% 0.38% 0.00% NA
Temperate Japonica  767 40.00% 53.70% 6.26% 0.00% NA
Tropical Japonica  504 98.40% 1.00% 0.60% 0.00% NA
Japonica Intermediate  241 80.10% 16.60% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901762072 T -> C LOC_Os09g03570.1 upstream_gene_variant ; 2701.0bp to feature; MODIFIER silent_mutation Average:72.441; most accessible tissue: Minghui63 root, score: 78.833 N N N N
vg0901762072 T -> C LOC_Os09g03580.1 upstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:72.441; most accessible tissue: Minghui63 root, score: 78.833 N N N N
vg0901762072 T -> C LOC_Os09g03570-LOC_Os09g03580 intergenic_region ; MODIFIER silent_mutation Average:72.441; most accessible tissue: Minghui63 root, score: 78.833 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901762072 NA 2.65E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 6.91E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 2.83E-06 1.94E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 6.83E-08 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 3.31E-06 1.57E-10 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 3.39E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 5.39E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 3.00E-08 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 1.68E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 1.71E-07 1.59E-09 mr1596_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 8.47E-06 3.83E-09 mr1596_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 1.49E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 2.80E-08 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 2.82E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 3.08E-07 3.39E-12 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901762072 NA 8.19E-11 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251