\
| Variant ID: vg0901739357 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1739357 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 58. )
GGCTTGCCCATAACCGAGGGCGCGGCTATTCGAATAGGTTATACTCTGATCAGAGGTCTACATCTTTACCCACAAGACACATCTTCCTCACGTGTAACCA[T/C]
GTGCCACATACCACCATGGTATATGGACGGAAGACGTGACATAGTTTCCAACCCATCCTAGCCATAGACAAGAGTACCGACCCAACCCCACCTACGGCCG
CGGCCGTAGGTGGGGTTGGGTCGGTACTCTTGTCTATGGCTAGGATGGGTTGGAAACTATGTCACGTCTTCCGTCCATATACCATGGTGGTATGTGGCAC[A/G]
TGGTTACACGTGAGGAAGATGTGTCTTGTGGGTAAAGATGTAGACCTCTGATCAGAGTATAACCTATTCGAATAGCCGCGCCCTCGGTTATGGGCAAGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 22.30% | 9.94% | 1.82% | NA |
| All Indica | 2759 | 97.30% | 2.10% | 0.43% | 0.14% | NA |
| All Japonica | 1512 | 4.50% | 64.50% | 25.93% | 5.09% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 4.40% | 0.50% | 0.17% | NA |
| Indica II | 465 | 98.10% | 1.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 2.90% | 0.51% | 0.38% | NA |
| Temperate Japonica | 767 | 0.80% | 96.90% | 1.83% | 0.52% | NA |
| Tropical Japonica | 504 | 9.70% | 22.20% | 56.94% | 11.11% | NA |
| Japonica Intermediate | 241 | 5.40% | 49.80% | 37.76% | 7.05% | NA |
| VI/Aromatic | 96 | 41.70% | 2.10% | 52.08% | 4.17% | NA |
| Intermediate | 90 | 58.90% | 22.20% | 17.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901739357 | T -> DEL | N | N | silent_mutation | Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0901739357 | T -> C | LOC_Os09g03520.1 | upstream_gene_variant ; 2041.0bp to feature; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0901739357 | T -> C | LOC_Os09g03540.1 | upstream_gene_variant ; 1389.0bp to feature; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0901739357 | T -> C | LOC_Os09g03550.1 | downstream_gene_variant ; 2630.0bp to feature; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0901739357 | T -> C | LOC_Os09g03530.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901739357 | NA | 6.94E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901739357 | 9.66E-07 | 6.97E-09 | mr1008 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | 7.66E-06 | NA | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | 2.32E-07 | 2.35E-09 | mr1009 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | 8.40E-06 | NA | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | NA | 2.35E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | NA | 9.76E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | NA | 1.08E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | NA | 3.20E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | NA | 2.36E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | NA | 3.16E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739357 | NA | 3.71E-08 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |