\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901739357:

Variant ID: vg0901739357 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1739357
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTTGCCCATAACCGAGGGCGCGGCTATTCGAATAGGTTATACTCTGATCAGAGGTCTACATCTTTACCCACAAGACACATCTTCCTCACGTGTAACCA[T/C]
GTGCCACATACCACCATGGTATATGGACGGAAGACGTGACATAGTTTCCAACCCATCCTAGCCATAGACAAGAGTACCGACCCAACCCCACCTACGGCCG

Reverse complement sequence

CGGCCGTAGGTGGGGTTGGGTCGGTACTCTTGTCTATGGCTAGGATGGGTTGGAAACTATGTCACGTCTTCCGTCCATATACCATGGTGGTATGTGGCAC[A/G]
TGGTTACACGTGAGGAAGATGTGTCTTGTGGGTAAAGATGTAGACCTCTGATCAGAGTATAACCTATTCGAATAGCCGCGCCCTCGGTTATGGGCAAGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 22.30% 9.94% 1.82% NA
All Indica  2759 97.30% 2.10% 0.43% 0.14% NA
All Japonica  1512 4.50% 64.50% 25.93% 5.09% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.00% 4.40% 0.50% 0.17% NA
Indica II  465 98.10% 1.30% 0.65% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 96.20% 2.90% 0.51% 0.38% NA
Temperate Japonica  767 0.80% 96.90% 1.83% 0.52% NA
Tropical Japonica  504 9.70% 22.20% 56.94% 11.11% NA
Japonica Intermediate  241 5.40% 49.80% 37.76% 7.05% NA
VI/Aromatic  96 41.70% 2.10% 52.08% 4.17% NA
Intermediate  90 58.90% 22.20% 17.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901739357 T -> DEL N N silent_mutation Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0901739357 T -> C LOC_Os09g03520.1 upstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0901739357 T -> C LOC_Os09g03540.1 upstream_gene_variant ; 1389.0bp to feature; MODIFIER silent_mutation Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0901739357 T -> C LOC_Os09g03550.1 downstream_gene_variant ; 2630.0bp to feature; MODIFIER silent_mutation Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0901739357 T -> C LOC_Os09g03530.1 intron_variant ; MODIFIER silent_mutation Average:35.369; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901739357 NA 6.94E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901739357 9.66E-07 6.97E-09 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 7.66E-06 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 2.32E-07 2.35E-09 mr1009 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 8.40E-06 NA mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 NA 2.35E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 NA 9.76E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 NA 1.08E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 NA 3.20E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 NA 2.36E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 NA 3.16E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901739357 NA 3.71E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251