Variant ID: vg0901691244 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 1691244 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 112. )
TGGTTGACGGAAGTCAAATTTCTGGGCCATGTCATTACAGCTCAGGGTGTGGCAGTTGATCCATCGAACGTGGAGTCAGTTACCAAATGGACCCCACCGA[G/A]
GACCGTGTCGCAGATTCGAAGTTTTCTTGGACTTGCAGGTTATTACCGCCGATTCATCGAAAACTTCTCCAGAATCGCCCGACCCATGACTCAGTTGCTT
AAGCAACTGAGTCATGGGTCGGGCGATTCTGGAGAAGTTTTCGATGAATCGGCGGTAATAACCTGCAAGTCCAAGAAAACTTCGAATCTGCGACACGGTC[C/T]
TCGGTGGGGTCCATTTGGTAACTGACTCCACGTTCGATGGATCAACTGCCACACCCTGAGCTGTAATGACATGGCCCAGAAATTTGACTTCCGTCAACCA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 23.00% | 2.60% | 35.23% | 39.17% | NA |
All Indica | 2759 | 2.80% | 3.50% | 39.00% | 54.69% | NA |
All Japonica | 1512 | 64.60% | 0.90% | 18.72% | 15.74% | NA |
Aus | 269 | 1.50% | 3.70% | 71.38% | 23.42% | NA |
Indica I | 595 | 4.70% | 1.80% | 25.04% | 68.40% | NA |
Indica II | 465 | 1.90% | 3.40% | 41.94% | 52.69% | NA |
Indica III | 913 | 0.90% | 4.10% | 44.80% | 50.27% | NA |
Indica Intermediate | 786 | 4.20% | 4.10% | 41.09% | 50.64% | NA |
Temperate Japonica | 767 | 97.00% | 0.00% | 0.78% | 2.22% | NA |
Tropical Japonica | 504 | 22.20% | 2.40% | 39.48% | 35.91% | NA |
Japonica Intermediate | 241 | 50.20% | 0.80% | 32.37% | 16.60% | NA |
VI/Aromatic | 96 | 1.00% | 1.00% | 87.50% | 10.42% | NA |
Intermediate | 90 | 30.00% | 2.20% | 33.33% | 34.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0901691244 | G -> DEL | LOC_Os09g03420.1 | N | frameshift_variant | Average:19.923; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
vg0901691244 | G -> A | LOC_Os09g03420.1 | missense_variant ; p.Arg1084Lys; MODERATE | nonsynonymous_codon ; R1084K | Average:19.923; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | benign | -0.31 | TOLERATED | 1.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0901691244 | NA | 4.21E-17 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 4.40E-08 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 8.53E-08 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 8.76E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | 8.93E-07 | NA | mr1188_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | 5.22E-06 | NA | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 1.38E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 3.77E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 7.47E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 6.84E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0901691244 | NA | 4.84E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |