\
| Variant ID: vg0901628621 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1628621 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCTCCACGTAGAGCGGATCTTCCGAAGCTGCGGCGTCTACACGACCAACGGAAAGGAAAAAGGCTTTTACTCTAATAAACTCCATATAACGAGCAGGAA[C/T]
AAAGCACAAAAATAGGTTCTTAACTTCTTAAGGGAAAATTAGAGACTTGAACGGTCCAATTCCGAGTTCAAATGGCCAAGTTATGGCCATTTGAAGTTTA
TAAACTTCAAATGGCCATAACTTGGCCATTTGAACTCGGAATTGGACCGTTCAAGTCTCTAATTTTCCCTTAAGAAGTTAAGAACCTATTTTTGTGCTTT[G/A]
TTCCTGCTCGTTATATGGAGTTTATTAGAGTAAAAGCCTTTTTCCTTTCCGTTGGTCGTGTAGACGCCGCAGCTTCGGAAGATCCGCTCTACGTGGAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.80% | 8.80% | 19.53% | 48.88% | NA |
| All Indica | 2759 | 3.00% | 1.20% | 21.86% | 73.98% | NA |
| All Japonica | 1512 | 64.60% | 21.60% | 7.67% | 6.22% | NA |
| Aus | 269 | 0.40% | 0.40% | 54.28% | 44.98% | NA |
| Indica I | 595 | 5.70% | 0.70% | 11.76% | 81.85% | NA |
| Indica II | 465 | 1.90% | 0.00% | 16.34% | 81.72% | NA |
| Indica III | 913 | 1.10% | 1.40% | 31.33% | 66.16% | NA |
| Indica Intermediate | 786 | 3.70% | 2.00% | 21.76% | 72.52% | NA |
| Temperate Japonica | 767 | 97.00% | 0.80% | 1.17% | 1.04% | NA |
| Tropical Japonica | 504 | 21.60% | 49.20% | 16.07% | 13.10% | NA |
| Japonica Intermediate | 241 | 51.00% | 29.90% | 10.79% | 8.30% | NA |
| VI/Aromatic | 96 | 1.00% | 42.70% | 46.88% | 9.38% | NA |
| Intermediate | 90 | 20.00% | 15.60% | 14.44% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901628621 | C -> DEL | N | N | silent_mutation | Average:38.951; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| vg0901628621 | C -> T | LOC_Os09g03360.1 | upstream_gene_variant ; 2248.0bp to feature; MODIFIER | silent_mutation | Average:38.951; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| vg0901628621 | C -> T | LOC_Os09g03350.1 | downstream_gene_variant ; 2484.0bp to feature; MODIFIER | silent_mutation | Average:38.951; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| vg0901628621 | C -> T | LOC_Os09g03350-LOC_Os09g03360 | intergenic_region ; MODIFIER | silent_mutation | Average:38.951; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901628621 | NA | 1.95E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | 3.60E-07 | NA | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | 2.23E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | 5.06E-07 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | 9.09E-09 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | 3.35E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | 1.22E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | NA | 2.50E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | 9.23E-07 | NA | mr1437_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | NA | 3.22E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901628621 | NA | 2.50E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |