\
| Variant ID: vg0901583779 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1583779 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.01, others allele: 0.00, population size: 72. )
TAAAAAGAATTTGGAAATAGCGGGAAAAGATCTTTACTCCTAGTTGATGAGAACAACCGGGACTAAAGATATCTTTAGTCCCAGTTGTTGAGAACAACCG[G/A]
GAGTAAAGATCTTTTCATTACTCCCGGTTGTTCTTAACAACCGGGACTAAAGATATCTTTAGTCCCGGTTGTTCTCATCAACCGGGAGTAAAGATCCGGG
CCCGGATCTTTACTCCCGGTTGATGAGAACAACCGGGACTAAAGATATCTTTAGTCCCGGTTGTTAAGAACAACCGGGAGTAATGAAAAGATCTTTACTC[C/T]
CGGTTGTTCTCAACAACTGGGACTAAAGATATCTTTAGTCCCGGTTGTTCTCATCAACTAGGAGTAAAGATCTTTTCCCGCTATTTCCAAATTCTTTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 39.60% | 3.47% | 0.97% | NA |
| All Indica | 2759 | 85.00% | 11.20% | 3.70% | 0.07% | NA |
| All Japonica | 1512 | 1.10% | 93.80% | 2.51% | 2.51% | NA |
| Aus | 269 | 86.20% | 10.80% | 2.97% | 0.00% | NA |
| Indica I | 595 | 88.40% | 9.60% | 2.02% | 0.00% | NA |
| Indica II | 465 | 82.60% | 11.40% | 6.02% | 0.00% | NA |
| Indica III | 913 | 87.10% | 9.60% | 3.29% | 0.00% | NA |
| Indica Intermediate | 786 | 81.60% | 14.10% | 4.07% | 0.25% | NA |
| Temperate Japonica | 767 | 0.40% | 99.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 1.80% | 85.90% | 5.75% | 6.55% | NA |
| Japonica Intermediate | 241 | 2.10% | 92.90% | 3.32% | 1.66% | NA |
| VI/Aromatic | 96 | 12.50% | 69.80% | 11.46% | 6.25% | NA |
| Intermediate | 90 | 43.30% | 51.10% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901583779 | G -> DEL | N | N | silent_mutation | Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0901583779 | G -> A | LOC_Os09g03300.1 | upstream_gene_variant ; 2902.0bp to feature; MODIFIER | silent_mutation | Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0901583779 | G -> A | LOC_Os09g03290.1 | downstream_gene_variant ; 1165.0bp to feature; MODIFIER | silent_mutation | Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0901583779 | G -> A | LOC_Os09g03290-LOC_Os09g03300 | intergenic_region ; MODIFIER | silent_mutation | Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901583779 | NA | 1.57E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 5.00E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 2.08E-32 | mr1081_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 2.10E-14 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 6.91E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 7.07E-08 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 8.09E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 1.65E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 1.87E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 2.40E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | 4.24E-06 | 4.24E-06 | mr1673_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 1.05E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 4.87E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 2.55E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 2.60E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | 1.59E-06 | NA | mr1889_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 1.20E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901583779 | NA | 1.54E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |