\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901583779:

Variant ID: vg0901583779 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1583779
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAAGAATTTGGAAATAGCGGGAAAAGATCTTTACTCCTAGTTGATGAGAACAACCGGGACTAAAGATATCTTTAGTCCCAGTTGTTGAGAACAACCG[G/A]
GAGTAAAGATCTTTTCATTACTCCCGGTTGTTCTTAACAACCGGGACTAAAGATATCTTTAGTCCCGGTTGTTCTCATCAACCGGGAGTAAAGATCCGGG

Reverse complement sequence

CCCGGATCTTTACTCCCGGTTGATGAGAACAACCGGGACTAAAGATATCTTTAGTCCCGGTTGTTAAGAACAACCGGGAGTAATGAAAAGATCTTTACTC[C/T]
CGGTTGTTCTCAACAACTGGGACTAAAGATATCTTTAGTCCCGGTTGTTCTCATCAACTAGGAGTAAAGATCTTTTCCCGCTATTTCCAAATTCTTTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 39.60% 3.47% 0.97% NA
All Indica  2759 85.00% 11.20% 3.70% 0.07% NA
All Japonica  1512 1.10% 93.80% 2.51% 2.51% NA
Aus  269 86.20% 10.80% 2.97% 0.00% NA
Indica I  595 88.40% 9.60% 2.02% 0.00% NA
Indica II  465 82.60% 11.40% 6.02% 0.00% NA
Indica III  913 87.10% 9.60% 3.29% 0.00% NA
Indica Intermediate  786 81.60% 14.10% 4.07% 0.25% NA
Temperate Japonica  767 0.40% 99.30% 0.13% 0.13% NA
Tropical Japonica  504 1.80% 85.90% 5.75% 6.55% NA
Japonica Intermediate  241 2.10% 92.90% 3.32% 1.66% NA
VI/Aromatic  96 12.50% 69.80% 11.46% 6.25% NA
Intermediate  90 43.30% 51.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901583779 G -> DEL N N silent_mutation Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0901583779 G -> A LOC_Os09g03300.1 upstream_gene_variant ; 2902.0bp to feature; MODIFIER silent_mutation Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0901583779 G -> A LOC_Os09g03290.1 downstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0901583779 G -> A LOC_Os09g03290-LOC_Os09g03300 intergenic_region ; MODIFIER silent_mutation Average:39.52; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901583779 NA 1.57E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 5.00E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 2.08E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 2.10E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 6.91E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 7.07E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 8.09E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 1.65E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 1.87E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 2.40E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 4.24E-06 4.24E-06 mr1673_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 1.05E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 4.87E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 2.55E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 2.60E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 1.59E-06 NA mr1889_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 1.20E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901583779 NA 1.54E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251