\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901555680:

Variant ID: vg0901555680 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 1555680
Reference Allele: GCTACGTAlternative Allele: G,ACTACGT
Primary Allele: GCTACGTSecondary Allele: ACTACGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGAACACCAGCTCATCAGTTGCGGAACCTGGACGCGATATTGAGGGAAGGCCCTTTTGATCCGGTAACAAACCTAGACACCAGCAGATGGGCAGAGTG[GCTACGT/G,ACTACGT]
GAGACCGTGACCAACCTCAACACCGCGTTTGCTGAAGCCGCAGGTGGCCCAGAGCCGAACAGAGATAGAGAGCGACTTACCGGAGATGCAGAGGATGAAA

Reverse complement sequence

TTTCATCCTCTGCATCTCCGGTAAGTCGCTCTCTATCTCTGTTCGGCTCTGGGCCACCTGCGGCTTCAGCAAACGCGGTGTTGAGGTTGGTCACGGTCTC[ACGTAGC/C,ACGTAGT]
CACTCTGCCCATCTGCTGGTGTCTAGGTTTGTTACCGGATCAAAAGGGCCTTCCCTCAATATCGCGTCCAGGTTCCGCAACTGATGAGCTGGTGTTCTCG

Allele Frequencies:

Populations Population SizeFrequency of GCTACGT(primary allele) Frequency of ACTACGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 6.80% 2.71% 4.04% G: 0.06%
All Indica  2759 96.80% 0.20% 0.87% 2.10% G: 0.04%
All Japonica  1512 71.20% 17.20% 4.50% 7.08% G: 0.07%
Aus  269 90.70% 0.00% 8.55% 0.74% NA
Indica I  595 99.50% 0.20% 0.17% 0.17% NA
Indica II  465 95.90% 0.00% 0.86% 3.23% NA
Indica III  913 96.60% 0.30% 0.66% 2.30% G: 0.11%
Indica Intermediate  786 95.40% 0.30% 1.65% 2.67% NA
Temperate Japonica  767 98.70% 0.10% 0.65% 0.52% NA
Tropical Japonica  504 32.70% 47.20% 5.36% 14.68% NA
Japonica Intermediate  241 63.90% 8.70% 14.94% 12.03% G: 0.41%
VI/Aromatic  96 24.00% 50.00% 8.33% 16.67% G: 1.04%
Intermediate  90 78.90% 6.70% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901555680 GCTACGT -> G LOC_Os09g03220.1 inframe_deletion ; p.Leu280_Arg281del; MODERATE inframe_variant Average:70.356; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0901555680 GCTACGT -> DEL LOC_Os09g03220.1 N frameshift_variant Average:70.356; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0901555680 GCTACGT -> ACTACGT LOC_Os09g03220.1 stop_gained ; p.Trp279*; HIGH stop_gained Average:70.356; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901555680 2.46E-06 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 1.19E-07 NA mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 NA 8.49E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 NA 2.86E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 6.29E-07 NA mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 7.97E-09 NA mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 4.72E-06 NA mr1079_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 9.23E-08 NA mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 1.32E-07 NA mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 1.10E-08 NA mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555680 1.57E-09 NA mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251