\
| Variant ID: vg0901555680 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 1555680 |
| Reference Allele: GCTACGT | Alternative Allele: G,ACTACGT |
| Primary Allele: GCTACGT | Secondary Allele: ACTACGT |
Inferred Ancestral Allele: Not determined.
CGAGAACACCAGCTCATCAGTTGCGGAACCTGGACGCGATATTGAGGGAAGGCCCTTTTGATCCGGTAACAAACCTAGACACCAGCAGATGGGCAGAGTG[GCTACGT/G,ACTACGT]
GAGACCGTGACCAACCTCAACACCGCGTTTGCTGAAGCCGCAGGTGGCCCAGAGCCGAACAGAGATAGAGAGCGACTTACCGGAGATGCAGAGGATGAAA
TTTCATCCTCTGCATCTCCGGTAAGTCGCTCTCTATCTCTGTTCGGCTCTGGGCCACCTGCGGCTTCAGCAAACGCGGTGTTGAGGTTGGTCACGGTCTC[ACGTAGC/C,ACGTAGT]
CACTCTGCCCATCTGCTGGTGTCTAGGTTTGTTACCGGATCAAAAGGGCCTTCCCTCAATATCGCGTCCAGGTTCCGCAACTGATGAGCTGGTGTTCTCG
| Populations | Population Size | Frequency of GCTACGT(primary allele) | Frequency of ACTACGT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.40% | 6.80% | 2.71% | 4.04% | G: 0.06% |
| All Indica | 2759 | 96.80% | 0.20% | 0.87% | 2.10% | G: 0.04% |
| All Japonica | 1512 | 71.20% | 17.20% | 4.50% | 7.08% | G: 0.07% |
| Aus | 269 | 90.70% | 0.00% | 8.55% | 0.74% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.17% | 0.17% | NA |
| Indica II | 465 | 95.90% | 0.00% | 0.86% | 3.23% | NA |
| Indica III | 913 | 96.60% | 0.30% | 0.66% | 2.30% | G: 0.11% |
| Indica Intermediate | 786 | 95.40% | 0.30% | 1.65% | 2.67% | NA |
| Temperate Japonica | 767 | 98.70% | 0.10% | 0.65% | 0.52% | NA |
| Tropical Japonica | 504 | 32.70% | 47.20% | 5.36% | 14.68% | NA |
| Japonica Intermediate | 241 | 63.90% | 8.70% | 14.94% | 12.03% | G: 0.41% |
| VI/Aromatic | 96 | 24.00% | 50.00% | 8.33% | 16.67% | G: 1.04% |
| Intermediate | 90 | 78.90% | 6.70% | 5.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901555680 | GCTACGT -> G | LOC_Os09g03220.1 | inframe_deletion ; p.Leu280_Arg281del; MODERATE | inframe_variant | Average:70.356; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0901555680 | GCTACGT -> DEL | LOC_Os09g03220.1 | N | frameshift_variant | Average:70.356; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0901555680 | GCTACGT -> ACTACGT | LOC_Os09g03220.1 | stop_gained ; p.Trp279*; HIGH | stop_gained | Average:70.356; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901555680 | 2.46E-06 | NA | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 1.19E-07 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | NA | 8.49E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | NA | 2.86E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 6.29E-07 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 7.97E-09 | NA | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 4.72E-06 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 9.23E-08 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 1.32E-07 | NA | mr1178_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 1.10E-08 | NA | mr1390_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901555680 | 1.57E-09 | NA | mr1490_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |