\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901555655:

Variant ID: vg0901555655 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1555655
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGAGACGAGCTCGTCCGCCGCTGCGAGAACACCAGCTCATCAGTTGCGGAACCTGGACGCGATATTGAGGGAAGGCCCTTTTGATCCGGTAACAAACC[T/C]
AGACACCAGCAGATGGGCAGAGTGGCTACGTGAGACCGTGACCAACCTCAACACCGCGTTTGCTGAAGCCGCAGGTGGCCCAGAGCCGAACAGAGATAGA

Reverse complement sequence

TCTATCTCTGTTCGGCTCTGGGCCACCTGCGGCTTCAGCAAACGCGGTGTTGAGGTTGGTCACGGTCTCACGTAGCCACTCTGCCCATCTGCTGGTGTCT[A/G]
GGTTTGTTACCGGATCAAAAGGGCCTTCCCTCAATATCGCGTCCAGGTTCCGCAACTGATGAGCTGGTGTTCTCGCAGCGGCGGACGAGCTCGTCTCAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 6.80% 3.11% 3.53% NA
All Indica  2759 96.80% 0.20% 1.01% 1.96% NA
All Japonica  1512 71.80% 17.50% 5.49% 5.29% NA
Aus  269 87.40% 0.00% 8.18% 4.46% NA
Indica I  595 99.50% 0.20% 0.17% 0.17% NA
Indica II  465 94.00% 0.00% 1.72% 4.30% NA
Indica III  913 97.20% 0.20% 0.88% 1.75% NA
Indica Intermediate  786 96.20% 0.30% 1.40% 2.16% NA
Temperate Japonica  767 98.80% 0.10% 0.78% 0.26% NA
Tropical Japonica  504 33.10% 48.20% 7.74% 10.91% NA
Japonica Intermediate  241 66.40% 8.30% 15.77% 9.54% NA
VI/Aromatic  96 24.00% 49.00% 12.50% 14.58% NA
Intermediate  90 83.30% 6.70% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901555655 T -> DEL LOC_Os09g03220.1 N frameshift_variant Average:67.742; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N
vg0901555655 T -> C LOC_Os09g03220.1 missense_variant ; p.Leu271Pro; MODERATE nonsynonymous_codon ; L271P Average:67.742; most accessible tissue: Zhenshan97 young leaf, score: 84.035 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901555655 2.25E-06 NA mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 8.65E-06 NA mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 5.88E-06 NA mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 8.57E-09 NA mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 NA 9.71E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 1.54E-06 NA mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 1.05E-06 NA mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 1.56E-07 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 7.52E-06 NA mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 1.86E-07 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 1.77E-07 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 3.81E-08 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901555655 1.32E-08 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251