\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901474384:

Variant ID: vg0901474384 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1474384
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATAAAGATGGAAGCACTAATCCTAAGAACACAATCCGTCATAACGAATTTTATCTCTTGTTGAAGATCGAAATCGATGCAGCTCAACCCGAAAGCAA[A/G]
AACTCGTCGAAACAAAACTAAAGCAAAAGGGTGGCGATGCGCCGAGATTGTATTGAACATGTGTGTTGTAAATTACATAGGGCTCGGGTCTATTTATACT

Reverse complement sequence

AGTATAAATAGACCCGAGCCCTATGTAATTTACAACACACATGTTCAATACAATCTCGGCGCATCGCCACCCTTTTGCTTTAGTTTTGTTTCGACGAGTT[T/C]
TTGCTTTCGGGTTGAGCTGCATCGATTTCGATCTTCAACAAGAGATAAAATTCGTTATGACGGATTGTGTTCTTAGGATTAGTGCTTCCATCTTTATGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.90% 0.10% 0.00% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901474384 A -> G LOC_Os09g03090.1 upstream_gene_variant ; 3941.0bp to feature; MODIFIER N Average:36.815; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0901474384 A -> G LOC_Os09g03100.1 upstream_gene_variant ; 757.0bp to feature; MODIFIER N Average:36.815; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0901474384 A -> G LOC_Os09g03110.1 downstream_gene_variant ; 4438.0bp to feature; MODIFIER N Average:36.815; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0901474384 A -> G LOC_Os09g03090-LOC_Os09g03100 intergenic_region ; MODIFIER N Average:36.815; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901474384 NA 1.50E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 3.18E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 5.96E-06 NA mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 6.26E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 2.99E-07 1.18E-06 mr1070_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 2.43E-06 2.06E-10 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 4.57E-07 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 1.47E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 4.16E-06 NA mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 5.53E-06 NA mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 4.86E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 3.78E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 4.05E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 3.89E-08 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 2.43E-07 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 6.21E-06 1.92E-08 mr1246_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 4.72E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 1.37E-07 6.60E-07 mr1437_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 NA 1.10E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901474384 2.29E-06 NA mr1949_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251