\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901473649:

Variant ID: vg0901473649 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1473649
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATATCATTTATCTTTGAGCTAATGTCATCTGTGTATCGATCGGCAGTCATGAATAAGTAAAGAAGAACTAAATCTACTCGATCGGCTGTAGATATTAA[T/C]
GATATATACTCCTTATATCGATGTATACTTAAATCAAGTGATTGGGATAGATCGGTCATCATGCCGAGACAGTATAAATCACTTTGATCGAAATATATAT

Reverse complement sequence

ATATATATTTCGATCAAAGTGATTTATACTGTCTCGGCATGATGACCGATCTATCCCAATCACTTGATTTAAGTATACATCGATATAAGGAGTATATATC[A/G]
TTAATATCTACAGCCGATCGAGTAGATTTAGTTCTTCTTTACTTATTCATGACTGCCGATCGATACACAGATGACATTAGCTCAAAGATAAATGATATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 15.00% 0.15% 0.00% NA
All Indica  2759 96.80% 3.10% 0.11% 0.00% NA
All Japonica  1512 65.90% 34.00% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 93.90% 5.90% 0.25% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 23.80% 75.80% 0.40% 0.00% NA
Japonica Intermediate  241 52.70% 47.30% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 89.60% 1.04% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901473649 T -> C LOC_Os09g03090.1 upstream_gene_variant ; 3206.0bp to feature; MODIFIER silent_mutation Average:34.91; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0901473649 T -> C LOC_Os09g03100.1 upstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:34.91; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0901473649 T -> C LOC_Os09g03090-LOC_Os09g03100 intergenic_region ; MODIFIER silent_mutation Average:34.91; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901473649 2.05E-06 7.74E-16 Grain_thickness Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901473649 NA 1.89E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901473649 NA 3.65E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 4.06E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 4.64E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 7.79E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 1.40E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 1.54E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 4.01E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 1.58E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 9.61E-10 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 1.74E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 1.62E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 8.29E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 1.63E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649 NA 7.12E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251