Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901473649:

Variant ID: vg0901473649 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1473649
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATATCATTTATCTTTGAGCTAATGTCATCTGTGTATCGATCGGCAGTCATGAATAAGTAAAGAAGAACTAAATCTACTCGATCGGCTGTAGATATTAA[T/C]
GATATATACTCCTTATATCGATGTATACTTAAATCAAGTGATTGGGATAGATCGGTCATCATGCCGAGACAGTATAAATCACTTTGATCGAAATATATAT

Reverse complement sequence

ATATATATTTCGATCAAAGTGATTTATACTGTCTCGGCATGATGACCGATCTATCCCAATCACTTGATTTAAGTATACATCGATATAAGGAGTATATATC[A/G]
TTAATATCTACAGCCGATCGAGTAGATTTAGTTCTTCTTTACTTATTCATGACTGCCGATCGATACACAGATGACATTAGCTCAAAGATAAATGATATGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	15.00%	0.15%	0.00%	NA
All Indica	2759	96.80%	3.10%	0.11%	0.00%	NA
All Japonica	1512	65.90%	34.00%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.30%	1.50%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.80%	3.20%	0.00%	0.00%	NA
Indica Intermediate	786	93.90%	5.90%	0.25%	0.00%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	23.80%	75.80%	0.40%	0.00%	NA
Japonica Intermediate	241	52.70%	47.30%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	89.60%	1.04%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901473649	T -> C	LOC_Os09g03090.1	upstream_gene_variant ; 3206.0bp to feature; MODIFIER	silent_mutation	Average:34.91; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0901473649	T -> C	LOC_Os09g03100.1	upstream_gene_variant ; 1492.0bp to feature; MODIFIER	silent_mutation	Average:34.91; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0901473649	T -> C	LOC_Os09g03090-LOC_Os09g03100	intergenic_region ; MODIFIER	silent_mutation	Average:34.91; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901473649	2.05E-06	7.74E-16	Grain_thickness	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901473649	NA	1.89E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901473649	NA	3.65E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	4.06E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	4.64E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	7.79E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	1.40E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	1.54E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	4.01E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	1.58E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	9.61E-10	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	1.74E-07	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	1.62E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	8.29E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	1.63E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901473649	NA	7.12E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251