\
| Variant ID: vg0901448401 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1448401 |
| Reference Allele: A | Alternative Allele: T,C |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 82. )
GCTTCAATGCCCTGAACTCACGTTTCTTCAAAGTAACAACTCCTACAGGTATGTGTGTCTTCTTGAATCCTTCGGTAAACTCTTCCCAATTGATTGGTTG[A/T,C]
CCTTCTGCTCTGTTCATCCGGAAATGATCCCACCATTCTGATGCAGGTCCTTGCAACTGATGTGAAGCGAAAACAACTTTCTCCTGATCCGTGCACTGGA
TCCAGTGCACGGATCAGGAGAAAGTTGTTTTCGCTTCACATCAGTTGCAAGGACCTGCATCAGAATGGTGGGATCATTTCCGGATGAACAGAGCAGAAGG[T/A,G]
CAACCAATCAATTGGGAAGAGTTTACCGAAGGATTCAAGAAGACACACATACCTGTAGGAGTTGTTACTTTGAAGAAACGTGAGTTCAGGGCATTGAAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 27.90% | 33.24% | 0.00% | C: 0.25% |
| All Indica | 2759 | 17.40% | 37.60% | 44.58% | 0.00% | C: 0.40% |
| All Japonica | 1512 | 80.80% | 1.70% | 17.46% | 0.00% | NA |
| Aus | 269 | 3.00% | 85.50% | 11.52% | 0.00% | NA |
| Indica I | 595 | 18.20% | 22.70% | 58.49% | 0.00% | C: 0.67% |
| Indica II | 465 | 19.40% | 34.60% | 46.02% | 0.00% | NA |
| Indica III | 913 | 14.60% | 51.90% | 33.30% | 0.00% | C: 0.22% |
| Indica Intermediate | 786 | 19.00% | 34.10% | 46.31% | 0.00% | C: 0.64% |
| Temperate Japonica | 767 | 98.30% | 0.10% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 51.40% | 3.80% | 44.84% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 2.50% | 10.79% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 5.20% | 10.42% | 0.00% | C: 1.04% |
| Intermediate | 90 | 38.90% | 21.10% | 40.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901448401 | A -> T | LOC_Os09g03060.1 | synonymous_variant ; p.Gly123Gly; LOW | synonymous_codon | Average:40.744; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 | N | N | N | N |
| vg0901448401 | A -> C | LOC_Os09g03060.1 | synonymous_variant ; p.Gly123Gly; LOW | synonymous_codon | Average:40.744; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901448401 | 2.20E-06 | 4.00E-18 | Grain_thickness | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901448401 | NA | 2.50E-15 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901448401 | NA | 3.92E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901448401 | NA | 4.37E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901448401 | NA | 2.38E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901448401 | NA | 1.75E-15 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901448401 | NA | 1.22E-13 | mr1879 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901448401 | NA | 1.76E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901448401 | NA | 2.69E-08 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |