\
| Variant ID: vg0901413043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1413043 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.12, others allele: 0.00, population size: 59. )
CACCCCTGACTGCCGAGTTCCTTACGACAGCCCGTCATGACCATCCAACCGGGGCTAAATACGGAGGAATACCCTCCCCAGGAAATTAACTTAGGATTAT[A/G]
TATAGGCGCGGAGGAATACTCGTAGTGAGCTGTCACCATCAGCGGCTCACCTCTTATCCGCAATATGTAACCCCAAATAATGATATCCCGTACTCTAGAC
GTCTAGAGTACGGGATATCATTATTTGGGGTTACATATTGCGGATAAGAGGTGAGCCGCTGATGGTGACAGCTCACTACGAGTATTCCTCCGCGCCTATA[T/C]
ATAATCCTAAGTTAATTTCCTGGGGAGGGTATTCCTCCGTATTTAGCCCCGGTTGGATGGTCATGACGGGCTGTCGTAAGGAACTCGGCAGTCAGGGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.90% | 26.20% | 0.11% | 11.81% | NA |
| All Indica | 2759 | 93.30% | 5.50% | 0.07% | 1.12% | NA |
| All Japonica | 1512 | 1.80% | 66.70% | 0.13% | 31.42% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 93.10% | 6.40% | 0.00% | 0.50% | NA |
| Indica II | 465 | 91.60% | 8.20% | 0.00% | 0.22% | NA |
| Indica III | 913 | 96.70% | 1.80% | 0.22% | 1.31% | NA |
| Indica Intermediate | 786 | 90.50% | 7.60% | 0.00% | 1.91% | NA |
| Temperate Japonica | 767 | 0.90% | 97.40% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 2.60% | 25.80% | 0.20% | 71.43% | NA |
| Japonica Intermediate | 241 | 2.90% | 54.40% | 0.41% | 42.32% | NA |
| VI/Aromatic | 96 | 11.50% | 52.10% | 0.00% | 36.46% | NA |
| Intermediate | 90 | 50.00% | 31.10% | 1.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901413043 | A -> G | LOC_Os09g03000.1 | upstream_gene_variant ; 2549.0bp to feature; MODIFIER | silent_mutation | Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 | N | N | N | N |
| vg0901413043 | A -> G | LOC_Os09g03010.1 | downstream_gene_variant ; 1951.0bp to feature; MODIFIER | silent_mutation | Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 | N | N | N | N |
| vg0901413043 | A -> G | LOC_Os09g03000-LOC_Os09g03010 | intergenic_region ; MODIFIER | silent_mutation | Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 | N | N | N | N |
| vg0901413043 | A -> DEL | N | N | silent_mutation | Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901413043 | NA | 4.22E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901413043 | 1.02E-06 | 1.02E-06 | mr1335_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901413043 | NA | 3.84E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901413043 | 2.24E-06 | 1.70E-08 | mr1680_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |