\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901413043:

Variant ID: vg0901413043 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1413043
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.12, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CACCCCTGACTGCCGAGTTCCTTACGACAGCCCGTCATGACCATCCAACCGGGGCTAAATACGGAGGAATACCCTCCCCAGGAAATTAACTTAGGATTAT[A/G]
TATAGGCGCGGAGGAATACTCGTAGTGAGCTGTCACCATCAGCGGCTCACCTCTTATCCGCAATATGTAACCCCAAATAATGATATCCCGTACTCTAGAC

Reverse complement sequence

GTCTAGAGTACGGGATATCATTATTTGGGGTTACATATTGCGGATAAGAGGTGAGCCGCTGATGGTGACAGCTCACTACGAGTATTCCTCCGCGCCTATA[T/C]
ATAATCCTAAGTTAATTTCCTGGGGAGGGTATTCCTCCGTATTTAGCCCCGGTTGGATGGTCATGACGGGCTGTCGTAAGGAACTCGGCAGTCAGGGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 26.20% 0.11% 11.81% NA
All Indica  2759 93.30% 5.50% 0.07% 1.12% NA
All Japonica  1512 1.80% 66.70% 0.13% 31.42% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 93.10% 6.40% 0.00% 0.50% NA
Indica II  465 91.60% 8.20% 0.00% 0.22% NA
Indica III  913 96.70% 1.80% 0.22% 1.31% NA
Indica Intermediate  786 90.50% 7.60% 0.00% 1.91% NA
Temperate Japonica  767 0.90% 97.40% 0.00% 1.69% NA
Tropical Japonica  504 2.60% 25.80% 0.20% 71.43% NA
Japonica Intermediate  241 2.90% 54.40% 0.41% 42.32% NA
VI/Aromatic  96 11.50% 52.10% 0.00% 36.46% NA
Intermediate  90 50.00% 31.10% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901413043 A -> G LOC_Os09g03000.1 upstream_gene_variant ; 2549.0bp to feature; MODIFIER silent_mutation Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0901413043 A -> G LOC_Os09g03010.1 downstream_gene_variant ; 1951.0bp to feature; MODIFIER silent_mutation Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0901413043 A -> G LOC_Os09g03000-LOC_Os09g03010 intergenic_region ; MODIFIER silent_mutation Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0901413043 A -> DEL N N silent_mutation Average:34.647; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901413043 NA 4.22E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901413043 1.02E-06 1.02E-06 mr1335_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901413043 NA 3.84E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901413043 2.24E-06 1.70E-08 mr1680_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251