Search for Variation information by Variation ID:
Detailed information for vg0901391504:
| Variant ID: vg0901391504 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1391504 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 50. )
Flanking Sequence (100 bp) in Reference Genome:
AACTAAATATCTTAGAATTCTCTTGACAGCAATCAAATGGCACTCTTTAGGCTCCGCTTGAAAATGGGCACACATGCAAACACTAAGCATGATGTCGGGA[T/C]
GAGATGCACATAAGTAAAGCAAAGATCCTATCATGGAGTGATATACCTTTTGGTCCACACATTTACCATTATCGTCGAGGTCTAGGTGTCCATTAGTAGG
Reverse complement sequence
CCTACTAATGGACACCTAGACCTCGACGATAATGGTAAATGTGTGGACCAAAAGGTATATCACTCCATGATAGGATCTTTGCTTTACTTATGTGCATCTC[A/G]
TCCCGACATCATGCTTAGTGTTTGCATGTGTGCCCATTTTCAAGCGGAGCCTAAAGAGTGCCATTTGATTGCTGTCAAGAGAATTCTAAGATATTTAGTT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.90% | 23.70% | 1.08% | 12.27% | NA |
| All Indica | 2759 | 94.80% | 2.60% | 0.87% | 1.74% | NA |
| All Japonica | 1512 | 1.90% | 67.20% | 1.06% | 29.83% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 93.40% | 5.70% | 0.34% | 0.50% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 96.70% | 0.10% | 1.10% | 2.08% | NA |
| Indica Intermediate | 786 | 91.30% | 3.90% | 1.53% | 3.18% | NA |
| Temperate Japonica | 767 | 0.80% | 97.70% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 3.00% | 26.60% | 2.38% | 68.06% | NA |
| Japonica Intermediate | 241 | 3.30% | 55.20% | 1.24% | 40.25% | NA |
| VI/Aromatic | 96 | 14.60% | 8.30% | 7.29% | 69.79% | NA |
| Intermediate | 90 | 54.40% | 26.70% | 4.44% | 14.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901391504 | T -> DEL | LOC_Os09g02960.1 | N | frameshift_variant | Average:36.871; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0901391504 | T -> C | LOC_Os09g02960.1 | missense_variant ; p.His1186Arg; MODERATE | nonsynonymous_codon ; H1186R | Average:36.871; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | benign  |
-0.862 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901391504 | NA | 4.56E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | NA | 1.34E-23 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | NA | 3.55E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | NA | 5.28E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | NA | 2.65E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | NA | 2.58E-08 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | 2.49E-06 | NA | mr1538_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | NA | 2.58E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901391504 | NA | 6.23E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |