Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901385906:

Variant ID: vg0901385906 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1385906
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGTGTCGGCGGGGAAGTTCTAAGGATTCATGGTGCATGAGAGAGGAGTTGAGATTGGTCCTAAGAAGATAGAAAAGATTCGTGATTTCAAAGCGCCG[G/A]
CATGCAAGAAGGAAGTACAAAAGTTGCTAGGTAAGGTGAATTATTTGAGAAGGTTTATTTCTAACCTAGCGGGTAAATCGATACTTTTGTTCCTATACTT

Reverse complement sequence

AAGTATAGGAACAAAAGTATCGATTTACCCGCTAGGTTAGAAATAAACCTTCTCAAATAATTCACCTTACCTAGCAACTTTTGTACTTCCTTCTTGCATG[C/T]
CGGCGCTTTGAAATCACGAATCTTTTCTATCTTCTTAGGACCAATCTCAACTCCTCTCTCATGCACCATGAATCCTTAGAACTTCCCCGCCGACACACCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	22.30%	3.36%	10.01%	NA
All Indica	2759	96.70%	2.00%	0.54%	0.80%	NA
All Japonica	1512	2.20%	64.60%	6.35%	26.79%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	94.30%	4.50%	0.17%	1.01%	NA
Indica II	465	98.50%	1.30%	0.00%	0.22%	NA
Indica III	913	98.90%	0.20%	0.33%	0.55%	NA
Indica Intermediate	786	94.80%	2.50%	1.40%	1.27%	NA
Temperate Japonica	767	0.50%	97.10%	0.00%	2.35%	NA
Tropical Japonica	504	4.20%	22.00%	14.68%	59.13%	NA
Japonica Intermediate	241	3.70%	50.20%	9.13%	36.93%	NA
VI/Aromatic	96	22.90%	1.00%	34.38%	41.67%	NA
Intermediate	90	55.60%	21.10%	16.67%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901385906	G -> DEL	N	N	silent_mutation	Average:32.978; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0901385906	G -> A	LOC_Os09g02950.1	intron_variant ; MODIFIER	silent_mutation	Average:32.978; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901385906	NA	7.55E-37	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906	NA	2.31E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906	5.12E-08	8.62E-57	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906	8.14E-08	1.54E-17	Grain_width	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906	NA	1.21E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	8.96E-16	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	8.73E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	1.19E-35	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	7.11E-11	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	8.37E-09	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	5.50E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	3.94E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	1.22E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	5.28E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	5.18E-07	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	1.85E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	1.26E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	2.14E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906	NA	3.90E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251