\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901360162:

Variant ID: vg0901360162 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1360162
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCTAGCCACAGATTAGCACTGATAAATGCCTCATCAGTGCCAATTTTTTTCCACCAATTGGCACAGTCCACCACATCAATGGAGGTTTCTTTCTTAA[A/G]
CCGTACTGATATTTGTCACTAGTGCCAGTTGTTGCCCTCCCGGAGCGTATGCGGGGCTAAGCGGGCAGGAGACTATCAATGCTGGTTTTTGTTTGTGTCT

Reverse complement sequence

AGACACAAACAAAAACCAGCATTGATAGTCTCCTGCCCGCTTAGCCCCGCATACGCTCCGGGAGGGCAACAACTGGCACTAGTGACAAATATCAGTACGG[T/C]
TTAAGAAAGAAACCTCCATTGATGTGGTGGACTGTGCCAATTGGTGGAAAAAAATTGGCACTGATGAGGCATTTATCAGTGCTAATCTGTGGCTAGAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 5.50% 0.63% 0.00% NA
All Indica  2759 99.70% 0.30% 0.07% 0.00% NA
All Japonica  1512 82.10% 16.10% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 98.70% 1.00% 0.26% 0.00% NA
Tropical Japonica  504 53.20% 43.30% 3.57% 0.00% NA
Japonica Intermediate  241 90.00% 7.50% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901360162 A -> G LOC_Os09g02890.1 upstream_gene_variant ; 3661.0bp to feature; MODIFIER silent_mutation Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0901360162 A -> G LOC_Os09g02900.1 downstream_gene_variant ; 788.0bp to feature; MODIFIER silent_mutation Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0901360162 A -> G LOC_Os09g02910.1 downstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0901360162 A -> G LOC_Os09g02900-LOC_Os09g02910 intergenic_region ; MODIFIER silent_mutation Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901360162 NA 9.57E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 1.46E-09 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 3.64E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 1.05E-06 1.05E-06 mr1208 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 5.12E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 1.80E-07 5.09E-10 mr1229 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 1.03E-06 1.94E-11 mr1229 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 1.25E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 1.02E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 5.96E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 7.71E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 1.12E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 4.97E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 2.76E-31 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 1.33E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 1.08E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 2.58E-18 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 7.57E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 2.22E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162 NA 5.91E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251