Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901360162:

Variant ID: vg0901360162 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1360162
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AATTCTAGCCACAGATTAGCACTGATAAATGCCTCATCAGTGCCAATTTTTTTCCACCAATTGGCACAGTCCACCACATCAATGGAGGTTTCTTTCTTAA[A/G]
CCGTACTGATATTTGTCACTAGTGCCAGTTGTTGCCCTCCCGGAGCGTATGCGGGGCTAAGCGGGCAGGAGACTATCAATGCTGGTTTTTGTTTGTGTCT

Reverse complement sequence

AGACACAAACAAAAACCAGCATTGATAGTCTCCTGCCCGCTTAGCCCCGCATACGCTCCGGGAGGGCAACAACTGGCACTAGTGACAAATATCAGTACGG[T/C]
TTAAGAAAGAAACCTCCATTGATGTGGTGGACTGTGCCAATTGGTGGAAAAAAATTGGCACTGATGAGGCATTTATCAGTGCTAATCTGTGGCTAGAATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	5.50%	0.63%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.07%	0.00%	NA
All Japonica	1512	82.10%	16.10%	1.72%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	98.70%	1.00%	0.26%	0.00%	NA
Tropical Japonica	504	53.20%	43.30%	3.57%	0.00%	NA
Japonica Intermediate	241	90.00%	7.50%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901360162	A -> G	LOC_Os09g02890.1	upstream_gene_variant ; 3661.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039	N	N	N	N
vg0901360162	A -> G	LOC_Os09g02900.1	downstream_gene_variant ; 788.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039	N	N	N	N
vg0901360162	A -> G	LOC_Os09g02910.1	downstream_gene_variant ; 958.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039	N	N	N	N
vg0901360162	A -> G	LOC_Os09g02900-LOC_Os09g02910	intergenic_region ; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Zhenshan97 young leaf, score: 75.039	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901360162	NA	9.57E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	1.46E-09	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	3.64E-08	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	1.05E-06	1.05E-06	mr1208	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	5.12E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	1.80E-07	5.09E-10	mr1229	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	1.03E-06	1.94E-11	mr1229	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	1.25E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	1.02E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	5.96E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	7.71E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	1.12E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	4.97E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	2.76E-31	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	1.33E-17	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	1.08E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	2.58E-18	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	7.57E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	2.22E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901360162	NA	5.91E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251