\
| Variant ID: vg0901346489 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1346489 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCA[G/A]
CCGACCATTCCTCCTGCAATGCTGAGCCCATCAGGAAATCGTAGGAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACACCATGCAAACCC
GGGTTTGCATGGTGTCCATGCTCTGTGATCCTACCTGCCCCGTTGAGGCGCAGCTCCTACGATTTCCTGATGGGCTCAGCATTGCAGGAGGAATGGTCGG[C/T]
TGGGGATCATGGGACCGATGTGCGGCCATGCGTTCATCAACCTTCCTTGCCACCTCCTCTTGCATGCTGAGCTCGTAGCTCGATACCCTGAACTCAAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 0.50% | 12.78% | 3.94% | NA |
| All Indica | 2759 | 95.30% | 0.00% | 2.25% | 2.39% | NA |
| All Japonica | 1512 | 67.50% | 1.40% | 24.21% | 6.94% | NA |
| Aus | 269 | 59.50% | 0.00% | 40.52% | 0.00% | NA |
| Indica I | 595 | 91.40% | 0.00% | 1.51% | 7.06% | NA |
| Indica II | 465 | 97.20% | 0.00% | 2.15% | 0.65% | NA |
| Indica III | 913 | 98.10% | 0.00% | 1.75% | 0.11% | NA |
| Indica Intermediate | 786 | 93.90% | 0.10% | 3.44% | 2.54% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 1.69% | 0.52% | NA |
| Tropical Japonica | 504 | 28.40% | 3.20% | 55.75% | 12.70% | NA |
| Japonica Intermediate | 241 | 52.70% | 2.10% | 29.88% | 15.35% | NA |
| VI/Aromatic | 96 | 36.50% | 0.00% | 50.00% | 13.54% | NA |
| Intermediate | 90 | 76.70% | 0.00% | 21.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901346489 | G -> DEL | LOC_Os09g02870.1 | N | frameshift_variant | Average:37.717; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| vg0901346489 | G -> A | LOC_Os09g02870.1 | synonymous_variant ; p.Gln379Gln; LOW | synonymous_codon | Average:37.717; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901346489 | NA | 8.18E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | NA | 3.06E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | NA | 2.28E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | 9.09E-08 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | NA | 2.64E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | NA | 4.97E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | NA | 2.45E-08 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | NA | 1.17E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | NA | 1.48E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | 2.05E-10 | NA | mr1238_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | 1.04E-11 | NA | mr1484_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | 8.46E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | 3.28E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | 2.19E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901346489 | 3.91E-09 | NA | mr1945_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |