\
| Variant ID: vg0901202336 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1202336 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 281. )
TATGGGCATCGGCTGGAACTAGTCCACCGGCTTGTCAGCTGATCAGCTCTTTGGTGATCTTCAATTTATATATCTTGTCAGTTGTAGGATCAAACTGACT[A/G]
GCACACCCACATCTCATCAAGTTTTGGTCATGCACTGGAGTTAAGCAGATCTCCCAGGTCGTTGTGTTTGTCGACTTAGTTCGCGCCAACACAGTTCCAG
CTGGAACTGTGTTGGCGCGAACTAAGTCGACAAACACAACGACCTGGGAGATCTGCTTAACTCCAGTGCATGACCAAAACTTGATGAGATGTGGGTGTGC[T/C]
AGTCAGTTTGATCCTACAACTGACAAGATATATAAATTGAAGATCACCAAAGAGCTGATCAGCTGACAAGCCGGTGGACTAGTTCCAGCCGATGCCCATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 9.60% | 1.08% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 69.20% | 27.60% | 3.17% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 45.20% | 49.40% | 5.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 15.80% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 12.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901202336 | A -> G | LOC_Os09g02690.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.025; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0901202336 | A -> G | LOC_Os09g02690.2 | intron_variant ; MODIFIER | silent_mutation | Average:51.025; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901202336 | NA | 1.47E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 1.61E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 3.20E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 4.16E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | 6.69E-06 | 4.30E-07 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 1.47E-07 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | 2.92E-06 | 1.08E-10 | mr1229_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 8.61E-09 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 2.73E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 3.41E-08 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 3.19E-06 | mr1555_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | 4.84E-07 | 4.25E-09 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 8.97E-09 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 2.79E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 2.45E-08 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 4.25E-06 | mr1763_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | 3.51E-07 | 3.14E-12 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901202336 | NA | 2.20E-10 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |